WormBase Tree Display for Variation: WBVar00248949
expand all nodes | collapse all nodes | view schema
| WBVar00248949 | Evidence | Paper_evidence | WBPaper00004273 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | sy247 | |||||||
| Other_name | CE43742:p.Gln528Ter | ||||||||
| C01C7.1b.1:c.1582C>T | |||||||||
| CE26967:p.Gln528Ter | |||||||||
| C01C7.1a.1:c.1582C>T | |||||||||
| HGVSg | CHROMOSOME_IV:g.12626375G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C01C7 | |||||
| Flanking_sequences | tcatcgtcaccgtcaacgtcgagaggatca | aagcttcgcctgcgccttctcatgttagtt | |||||||
| Mapping_target | C01C7 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004273 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00030839 | ||||||||
| WBStrain00030876 | |||||||||
| Laboratory | PS | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000186 | |||||||
| Transcript (2) | |||||||||
| Interactor | WBInteraction000006001 | ||||||||
| WBInteraction000006002 | |||||||||
| WBInteraction000006003 | |||||||||
| WBInteraction000006004 | |||||||||
| WBInteraction000006005 | |||||||||
| WBInteraction000006006 | |||||||||
| WBInteraction000006007 | |||||||||
| WBInteraction000006008 | |||||||||
| WBInteraction000006009 | |||||||||
| WBInteraction000006010 | |||||||||
| WBInteraction000006011 | |||||||||
| WBInteraction000006012 | |||||||||
| WBInteraction000006013 | |||||||||
| WBInteraction000006014 | |||||||||
| WBInteraction000006015 | |||||||||
| WBInteraction000006016 | |||||||||
| WBInteraction000006017 | |||||||||
| WBInteraction000006018 | |||||||||
| WBInteraction000500501 | |||||||||
| WBInteraction000503721 | |||||||||
| WBInteraction000520040 | |||||||||
| Genetics | Interpolated_map_position | IV | 6.12245 | ||||||
| Description | Phenotype | WBPhenotype:0000414 | Paper_evidence | WBPaper00004273 | |||||
| Curator_confirmed | WBPerson625 | ||||||||
| Remark | cell fate transformation | Paper_evidence | WBPaper00004273 | ||||||
| Curator_confirmed | WBPerson625 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004273 | ||||
| Curator_confirmed | WBPerson625 | ||||||||
| WBPhenotype:0000699 | Paper_evidence | WBPaper00004273 | |||||||
| Curator_confirmed | WBPerson625 | ||||||||
| Remark | additional vulval differentiation | Paper_evidence | WBPaper00004273 | ||||||
| Curator_confirmed | WBPerson625 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004273 | ||||
| Curator_confirmed | WBPerson625 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00004273 | ||||||||
| WBPaper00031110 | |||||||||
| Method | Substitution_allele |
