WormBase Tree Display for Variation: WBVar00248949
expand all nodes | collapse all nodes | view schema
WBVar00248949 | Evidence | Paper_evidence | WBPaper00004273 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy247 | |||||
Other_name | CE43742:p.Gln528Ter | ||||||
C01C7.1b.1:c.1582C>T | |||||||
CE26967:p.Gln528Ter | |||||||
C01C7.1a.1:c.1582C>T | |||||||
HGVSg | CHROMOSOME_IV:g.12626375G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | C01C7 | |||
Flanking_sequences | tcatcgtcaccgtcaacgtcgagaggatca | aagcttcgcctgcgccttctcatgttagtt | |||||
Mapping_target | C01C7 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004273 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00030839 | ||||||
WBStrain00030876 | |||||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000186 | |||||
Transcript | C01C7.1a.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | C01C7.1a.1:c.1582C>T | ||||||
HGVSp | CE26967:p.Gln528Ter | ||||||
cDNA_position | 1638 | ||||||
CDS_position | 1582 | ||||||
Protein_position | 528 | ||||||
Exon_number | 8/14 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
C01C7.1b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | C01C7.1b.1:c.1582C>T | ||||||
HGVSp | CE43742:p.Gln528Ter | ||||||
cDNA_position | 1638 | ||||||
CDS_position | 1582 | ||||||
Protein_position | 528 | ||||||
Exon_number | 8/14 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000006001 | ||||||
WBInteraction000006002 | |||||||
WBInteraction000006003 | |||||||
WBInteraction000006004 | |||||||
WBInteraction000006005 | |||||||
WBInteraction000006006 | |||||||
WBInteraction000006007 | |||||||
WBInteraction000006008 | |||||||
WBInteraction000006009 | |||||||
WBInteraction000006010 | |||||||
WBInteraction000006011 | |||||||
WBInteraction000006012 | |||||||
WBInteraction000006013 | |||||||
WBInteraction000006014 | |||||||
WBInteraction000006015 | |||||||
WBInteraction000006016 | |||||||
WBInteraction000006017 | |||||||
WBInteraction000006018 | |||||||
WBInteraction000500501 | |||||||
WBInteraction000503721 | |||||||
WBInteraction000520040 | |||||||
Genetics | Interpolated_map_position | IV | 6.12245 | ||||
Description | Phenotype (2) | ||||||
Phenotype_not_observed | WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00004273 | ||||||
WBPaper00031110 | |||||||
Method | Substitution_allele |