WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e61 | |||||
Other_name | e61sd | ||||||
F27C1.8.1:c.607G>T | |||||||
CE09720:p.Gly203Ter | |||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||
Mapping_target | F27C1 | ||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (325) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001067 | |||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F27C1.8.1:c.607G>T | ||||||
HGVSp | CE09720:p.Gly203Ter | ||||||
cDNA_position | 607 | ||||||
CDS_position | 607 | ||||||
Protein_position | 203 | ||||||
Exon_number | 1/1 | ||||||
Codon_change | Gga/Tga | ||||||
Amino_acid_change | G/* | ||||||
Interactor (7) | |||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||
Mapping_data | In_2_point (165) | ||||||
In_multi_point (349) | |||||||
In_pos_neg_data | 465 | ||||||
508 | |||||||
2129 | |||||||
2515 | |||||||
3747 | |||||||
3962 | |||||||
3970 | |||||||
3977 | |||||||
3988 | |||||||
3996 | |||||||
4006 | |||||||
4009 | |||||||
4012 | |||||||
4015 | |||||||
4016 | |||||||
4023 | |||||||
4029 | |||||||
4036 | |||||||
4043 | |||||||
4050 | |||||||
4057 | |||||||
4064 | |||||||
4072 | |||||||
4078 | |||||||
4088 | |||||||
4990 | |||||||
4994 | |||||||
5000 | |||||||
5042 | |||||||
5052 | |||||||
5061 | |||||||
5069 | |||||||
5085 | |||||||
5092 | |||||||
5325 | |||||||
5703 | |||||||
5852 | |||||||
6019 | |||||||
6143 | |||||||
6197 | |||||||
6314 | |||||||
6358 | |||||||
6374 | |||||||
6404 | |||||||
6427 | |||||||
6433 | |||||||
6447 | |||||||
6451 | |||||||
6466 | |||||||
6472 | |||||||
6479 | |||||||
6486 | |||||||
6491 | |||||||
6498 | |||||||
6506 | |||||||
6522 | |||||||
6528 | |||||||
6537 | |||||||
6540 | |||||||
6551 | |||||||
6563 | |||||||
6595 | |||||||
6602 | |||||||
6607 | |||||||
6613 | |||||||
6625 | |||||||
6643 | |||||||
6659 | |||||||
7281 | |||||||
7287 | |||||||
8065 | |||||||
8087 | |||||||
Description (2) | |||||||
Reference (45) | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |