WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e61 | |||||
Other_name | e61sd | ||||||
F27C1.8.1:c.607G>T | |||||||
CE09720:p.Gly203Ter | |||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||
Mapping_target | F27C1 | ||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (325) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (3) | |||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||
Mapping_data | In_2_point | 1 | |||||
3 | |||||||
4 | |||||||
6 | |||||||
7 | |||||||
8 | |||||||
9 | |||||||
10 | |||||||
11 | |||||||
12 | |||||||
13 | |||||||
14 | |||||||
15 | |||||||
16 | |||||||
17 | |||||||
18 | |||||||
19 | |||||||
20 | |||||||
22 | |||||||
23 | |||||||
24 | |||||||
25 | |||||||
26 | |||||||
27 | |||||||
29 | |||||||
31 | |||||||
205 | |||||||
211 | |||||||
238 | |||||||
239 | |||||||
240 | |||||||
241 | |||||||
243 | |||||||
246 | |||||||
247 | |||||||
259 | |||||||
265 | |||||||
330 | |||||||
391 | |||||||
392 | |||||||
393 | |||||||
394 | |||||||
410 | |||||||
424 | |||||||
441 | |||||||
442 | |||||||
446 | |||||||
464 | |||||||
472 | |||||||
478 | |||||||
490 | |||||||
524 | |||||||
561 | |||||||
565 | |||||||
566 | |||||||
570 | |||||||
572 | |||||||
574 | |||||||
599 | |||||||
602 | |||||||
614 | |||||||
618 | |||||||
642 | |||||||
643 | |||||||
646 | |||||||
738 | |||||||
787 | |||||||
788 | |||||||
1019 | |||||||
2492 | |||||||
2493 | |||||||
2494 | |||||||
2495 | |||||||
2497 | |||||||
2498 | |||||||
2499 | |||||||
2500 | |||||||
2501 | |||||||
2502 | |||||||
2505 | |||||||
2506 | |||||||
2520 | |||||||
2521 | |||||||
2522 | |||||||
2523 | |||||||
2524 | |||||||
2525 | |||||||
2526 | |||||||
2527 | |||||||
2528 | |||||||
2529 | |||||||
2530 | |||||||
2531 | |||||||
2532 | |||||||
2533 | |||||||
2534 | |||||||
2535 | |||||||
2536 | |||||||
2537 | |||||||
2538 | |||||||
2539 | |||||||
2540 | |||||||
2541 | |||||||
2542 | |||||||
2543 | |||||||
2544 | |||||||
2545 | |||||||
2546 | |||||||
2547 | |||||||
2548 | |||||||
2549 | |||||||
2550 | |||||||
2551 | |||||||
2552 | |||||||
2553 | |||||||
2554 | |||||||
2555 | |||||||
2556 | |||||||
2590 | |||||||
2591 | |||||||
3194 | |||||||
3195 | |||||||
3197 | |||||||
3198 | |||||||
3199 | |||||||
3203 | |||||||
3206 | |||||||
3209 | |||||||
3684 | |||||||
3685 | |||||||
3686 | |||||||
4228 | |||||||
4747 | |||||||
5225 | |||||||
5230 | |||||||
5246 | |||||||
5252 | |||||||
5518 | |||||||
5837 | |||||||
6024 | |||||||
6029 | |||||||
6030 | |||||||
6031 | |||||||
6032 | |||||||
6033 | |||||||
6041 | |||||||
6042 | |||||||
6043 | |||||||
6049 | |||||||
6050 | |||||||
6051 | |||||||
6064 | |||||||
6068 | |||||||
6070 | |||||||
6078 | |||||||
6079 | |||||||
6081 | |||||||
6082 | |||||||
6084 | |||||||
6085 | |||||||
6086 | |||||||
6087 | |||||||
6171 | |||||||
6194 | |||||||
6221 | |||||||
In_multi_point (349) | |||||||
In_pos_neg_data (72) | |||||||
Description (2) | |||||||
Reference (45) | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |