WormBase Tree Display for Variation: WBVar00088912
expand all nodes | collapse all nodes | view schema
WBVar00088912 | Evidence | Paper_evidence | WBPaper00003568 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mg142 | ||||||
Other_name | H42K12.1a.1:c.908C>T | |||||||
H42K12.1b.1:c.914C>T | ||||||||
CE28740:p.Ala305Val | ||||||||
CE28739:p.Ala303Val | ||||||||
HGVSg | CHROMOSOME_X:g.1325256C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | H33H01 | ||||
Flanking_sequences | gattgggatgtatccttttccagtgtctag | cggacagccaccattcagagccgtcaacca | ||||||
Mapping_target | H33H01 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003568 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007900 | |||||||
WBStrain00030725 | ||||||||
WBStrain00030727 | ||||||||
Laboratory | GR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003965 | ||||||
Transcript | H42K12.1b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
SIFT | 0.01 | deleterious | ||||||
PolyPhen | 0.981 | probably_damaging | ||||||
HGVSc | H42K12.1b.1:c.914C>T | |||||||
HGVSp | CE28740:p.Ala305Val | |||||||
cDNA_position | 933 | |||||||
CDS_position | 914 | |||||||
Protein_position | 305 | |||||||
Exon_number | 7/13 | |||||||
Codon_change | gCc/gTc | |||||||
Amino_acid_change | A/V | |||||||
H42K12.1a.1 (12) | ||||||||
Interactor | WBInteraction000518715 | |||||||
WBInteraction000518718 | ||||||||
WBInteraction000524615 | ||||||||
Genetics | Interpolated_map_position | X | -18.3874 | |||||
Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00029116 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Remark | Rescues movement defect in daf-2(m41) | Paper_evidence | WBPaper00029116 | |||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_assay | Genotype | daf-2(m41) | Paper_evidence | WBPaper00029116 | ||||
Curator_confirmed | WBPerson1754 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00003568 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Lifespan is slightly shortened compared to wild type. | Paper_evidence | WBPaper00003568 | |||||
Curator_confirmed | WBPerson712 | |||||||
Dominant | Paper_evidence | WBPaper00003568 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00003568 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | sqt-1(sc13) | Paper_evidence | WBPaper00003568 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00029116 | ||||||
Curator_confirmed | WBPerson1754 | |||||||
Remark (2) | ||||||||
Affected_by | Molecule | WBMol:00005384 | Paper_evidence | WBPaper00029116 | ||||
Curator_confirmed | WBPerson1754 | |||||||
Phenotype_assay | Genotype | daf-2(m41) | Paper_evidence | WBPaper00029116 | ||||
Curator_confirmed | WBPerson1754 | |||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was impaired in pdk-1(mg142) insulin-like signaling pathway mutants, resulting in fewer animals crossing the copper barrier to get to the diacetyl spot than in wild type controls (Figure 1C) | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBMol:00002819 | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004016 | Paper_evidence | WBPaper00050708 | ||||||
Curator_confirmed | WBPerson14035 | |||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on transgene analysis with a reporter. | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00003568 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The mg142 dominant Daf-c suppressor mutation has no phenotype on its own. | Paper_evidence | WBPaper00003568 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00037970 | |||||||
WBPaper00028886 | ||||||||
WBPaper00003568 | ||||||||
WBPaper00029116 | ||||||||
WBPaper00015792 | ||||||||
WBPaper00050708 | ||||||||
Method | Substitution_allele |