WormBase Tree Display for Variation: WBVar02123600
expand all nodes | collapse all nodes | view schema
WBVar02123600 | Name | Public_name | WBVar02123600 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854523 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | CGACAAATGTTTTGTCAGTTGACAGCATTTTTATTAGACAACTGAAATTTGAGCTACAGGCTAGAGTTTGGAATAGTATG | CCGGCCAGAAGCAGCTAAACTAGCGAAAAG | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 14304001 | 14314000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin (5) | ||||||||
Affects | Gene | WBGene00045332 | ||||||
WBGene00008794 | ||||||||
WBGene00008798 | ||||||||
WBGene00077695 | ||||||||
WBGene00008797 | ||||||||
WBGene00008793 | ||||||||
WBGene00009802 | ||||||||
WBGene00045490 | ||||||||
WBGene00008795 | ||||||||
WBGene00045491 | ||||||||
WBGene00077575 | ||||||||
Transcript (11) | ||||||||
Pseudogene | F14D7.13 | |||||||
F14D7.16 | ||||||||
F14D7.17 | ||||||||
F14D7.15 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |