WormBase Tree Display for Variation: WBVar00143473
expand all nodes | collapse all nodes | view schema
WBVar00143473 | Evidence | Person_evidence | WBPerson10095 | |||
---|---|---|---|---|---|---|
Name | Public_name | e771 | ||||
Other_name | C09G5.6.1:c.2243G>A | |||||
CE35827:p.Arg748Lys | ||||||
C09G5.2a.1:c.797+803C>T | ||||||
HGVSg | CHROMOSOME_II:g.10711347G>A | |||||
Sequence_details | SMap | S_parent | Sequence | C09G5 | ||
Flanking_sequences | agaaggttgagatcatcagacacccagaaa | aggatacgatcgtcgtcagccatcttatga | ||||
Mapping_target | C09G5 | |||||
Type_of_mutation | Substitution | g | a | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin (4) | ||||||
Affects | Gene | WBGene00007488 | ||||
WBGene00000251 | ||||||
Transcript | C09G5.2a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | |||||
HGVSc | C09G5.2a.1:c.797+803C>T | |||||
Intron_number | 6/10 | |||||
C09G5.6.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | |||||
SIFT | 0 | deleterious_low_confidence | ||||
PolyPhen | 0.805 | possibly_damaging | ||||
HGVSc | C09G5.6.1:c.2243G>A | |||||
HGVSp | CE35827:p.Arg748Lys | |||||
cDNA_position | 2297 | |||||
CDS_position | 2243 | |||||
Protein_position | 748 | |||||
Exon_number | 4/7 | |||||
Codon_change | aGa/aAa | |||||
Amino_acid_change | R/K | |||||
Genetics | Interpolated_map_position | II | 3.12417 | |||
Remark | alt_det = g to a mut_det = R748K | Person_evidence | WBPerson10095 | |||
Curator_confirmed | WBPerson51134 | |||||
Variation information submitted by WBPerson10095 on 2022-02-17_11:45:46 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||
Method | Substitution_allele |