Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Transgene: WBTransgene00008361

expand all nodes | collapse all nodes | view schema

Name Class

WBTransgene00008361Public_nameswIs37
Summary[pEXPR-lin-53::TAPtag]
Construction (2)
Construction_summarypBS1479 TAP-tag containing vector and pMM016b genomic unc-119 containing vector were digested with HindIII and NotI. unc-119 fragment was ligated into digested pBS1479 to produce pBSunc-119. This vector was digested with NcoI, blunted with Klenow enzyme and an RfA cassette of Invitrogen Gateway vector conversion system was ligated. It was subsequently digested with HindIII and a PCR amplified unc-54 39UTR with HindIII flanking sequences was inserted to produce pDEST-TAPtag. Primers: unc-54 3'UTRl aagcttgtccaattactcttcaacatcc and unc-54 3'UTRr aagcttataaggtattttgtgtgcgg. Promoter and coding sequence of lin-53 were amplified with Finnzyme Phusion polymerase. Primers: lin-53attB1left gggacaagtttgtacaaaaaagcaggctgctcaaaatcacgagaatcc and lin-53attB2right ggggaccactttgtacaagaaagctgggtcctgttgtctctctaccacatcg. PCR products were recombined with pDONR201 by Gateway BP recombination to produce pENTR-lin-53. Entry clones were recombined by LR recombination with pDEST-TAPtag to produce pEXPR-LIN-53::TAP.
Genetic_informationIntegrated
ReferenceWBPaper00037765
SpeciesCaenorhabditis elegans