WormBase Tree Display for Transgene: WBTransgene00005208
expand all nodes | collapse all nodes | view schema
WBTransgene00005208 | Public_name | zEx373 | |
---|---|---|---|
Summary | [sod-3::sod-3-gfp] | ||
Construction | Construct | WBCnstr00005185 | |
Construction_summary | Primers sod3u1 CCGTCGACCGCAGAAAAAAGTCGTTGCAA and sod3d1 TACCCGGGATTGTCGAGCATTGCAAATCT were used to amplify a 2.3-kb fragment from N2 genomic DNA, digested with SalI/XmaI, and cloned into pPD95.81 to create the sod-3::GFP expression vector. N2 animals were given injections of 20 ug/mL sod-3::GFP plasmid and 100 ug/mL pRF4 to establish transgenic lines N2; zEx373 (TJ373) and N2; zEx374 (TJ374). --precise ends. | ||
Genetic_information | Extrachromosomal | ||
Associated_with | Strain | WBStrain00034893 | |
Reference | WBPaper00027639 | ||
Species | Caenorhabditis elegans |