WormBase Tree Display for Construct: WBCnstr00005185
expand all nodes | collapse all nodes | view schema
WBCnstr00005185 | Summary | [sod-3::sod-3-gfp] | |
---|---|---|---|
Driven_by_gene | WBGene00004932 | ||
Gene | WBGene00004932 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Translational_fusion | ||
Construction_summary | Primers sod3u1 CCGTCGACCGCAGAAAAAAGTCGTTGCAA and sod3d1 TACCCGGGATTGTCGAGCATTGCAAATCT were used to amplify a 2.3-kb fragment from N2 genomic DNA, digested with SalI/XmaI, and cloned into pPD95.81 to create the sod-3::GFP expression vector. N2 animals were given injections of 20 ug/mL sod-3::GFP plasmid and 100 ug/mL pRF4 to establish transgenic lines N2; zEx373 (TJ373) and N2; zEx374 (TJ374). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00005208 | |
Reference | WBPaper00027639 |