WormBase Tree Display for Strain: WBStrain00055535
expand all nodes | collapse all nodes | view schema
| WBStrain00055535 | Genotype | ZK622.4(hd7010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. | ||
|---|---|---|---|---|
| Public_name | RG5060 | |||
| Contains | Gene | WBGene00001072 | ||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Variation | WBVar00142982 | |||
| Rearrangement | mIn1 | |||
| Transgene | WBTransgene00033209 | |||
| Properties | Outcrossed | x5 | ||
| CGC_received | 12 Jun 2023 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson14989 | |||
| Remark | umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
