WormBase Tree Display for Strain: WBStrain00055491
expand all nodes | collapse all nodes | view schema
| WBStrain00055491 | Genotype | +/nT1 [umnIs49] IV; trpp-6(ve848[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | ||
|---|---|---|---|---|
| Public_name | RG3348 | |||
| Contains | Gene | WBGene00003514 | ||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| WBGene00010699 | ||||
| Rearrangement | nT1 | |||
| Transgene | WBTransgene00033215 | |||
| Properties | Mutagen | CRISPR_Cas9 | ||
| CGC_received | 18 Apr 2023 00:00:00 | |||
| Location | CGC | |||
| Remark | umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval lethal. Deletion of 605 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve848 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAAATTATCCGTTCAACTTTGGAAAGTGA; Right flanking sequence: CGGAGCCCTTGCTGGTCTTAATATTAGAGT. trpp-6 sgRNA #1: AAAAGATCGATGTGAAGCAA; trpp-6 sgRNA #2: GCTCCGCGAAGTAAACCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
