WormBase Tree Display for Strain: WBStrain00054542
expand all nodes | collapse all nodes | view schema
WBStrain00054542 | Status | Live | ||
---|---|---|---|---|
Genotype | cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. | |||
Public_name | ZT34 | |||
Contains (2) | ||||
Properties | Outcrossed | x1 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 02 Jun 2023 00:00:00 | |||
Location | ZT | |||
CGC | ||||
Made_by | WBPerson1503 | |||
Remark | Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | Inferred_automatically | From CGC strain data | |
Reference | WBPaper00065293 | |||
Species | Caenorhabditis elegans |