WormBase Tree Display for Strain: WBStrain00051617
expand all nodes | collapse all nodes | view schema
| WBStrain00051617 | Status | Live | ||
|---|---|---|---|---|
| Genotype | mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. | |||
| Public_name | CGC137 | |||
| Contains | Gene | WBGene00001182 | ||
| WBGene00002957 | ||||
| WBGene00003335 | ||||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 10 Aug 2020 00:00:00 | |||
| Location | CGC | |||
| Remark | Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG. | Inferred_automatically | From CGC strain data | |
| Made_by: Marcus Vargas & Julie Knott | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
