WormBase Tree Display for Strain: WBStrain00049346
expand all nodes | collapse all nodes | view schema
| WBStrain00049346 | Evidence | Curator_confirmed | WBPerson1983 | |
|---|---|---|---|---|
| Status | Live | |||
| Genotype | rpb-12(ve607[loxP+myo2-p::GFP+NeoR+loxP])/nT1[umnIs49] IV; +/nT1 V. | |||
| Public_name | RG3107 | |||
| Contains | Gene | WBGene00009078 | ||
| Variation | WBVar02154166 | |||
| Rearrangement | nT1 | |||
| Transgene | WBTransgene00033215 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 10 Jul 2020 00:00:00 | |||
| Location | CGC | |||
| Remark | umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 437 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve607 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaagatcaagtatgaaatttaaaattcaac ; Right flanking sequence: ttgttaatgaaatgcgaaacgataaatttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | |||
| umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 437 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve607 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaagatcaagtatgaaatttaaaattcaac ; Right flanking sequence: ttgttaatgaaatgcgaaacgataaatttt. rpb-12 sgRNA #1: ggctgaacctgtatcatttt;rpb-12 sgRNA #2: ttaaagatattcagaATGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
