WormBase Tree Display for Strain: WBStrain00033394
expand all nodes | collapse all nodes | view schema
| WBStrain00033394 | Status | Live | ||
|---|---|---|---|---|
| Genotype | dat-1(ok157) III. | |||
| Public_name | RM2702 | |||
| Contains | Gene | WBGene00000934 | ||
| Variation | WBVar00091482 | |||
| Properties | Outcrossed | x6 | ||
| Mutagen | UV+TMP | |||
| CGC_received | 03 Oct 2005 00:00:00 | |||
| Location | CGC | |||
| RM | ||||
| Made_by | WBPerson2834 | |||
| Remark | Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA | |||
| Made_by: B Barstead/G Mullen | CGC_data_submission | |||
| Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
| WBStrain mapped, WBPaper00061409 added based on AFP_Strain data. | Curator_confirmed | WBPerson1983 | ||
| WBStrain mapped, WBPaper00061527 added based on AFP_Strain data. | Curator_confirmed | WBPerson1983 | ||
| Reference | WBPaper00064995 | |||
| Species | Caenorhabditis elegans |
