WormBase Tree Display for Strain: WBStrain00027508
expand all nodes | collapse all nodes | view schema
| WBStrain00027508 | Status | Live | ||||||
|---|---|---|---|---|---|---|---|---|
| Genotype | mir-58.1(n4640) IV. | |||||||
| Public_name | MT15024 | |||||||
| Contains | Gene | WBGene00003286 | ||||||
| Variation | WBVar00090890 | |||||||
| Properties | Outcrossed | x0 | ||||||
| Mutagen | EMS | |||||||
| CGC_received | 21 Feb 2007 00:00:00 | |||||||
| Phenotype | WBPhenotype:0001014 | Paper_evidence | WBPaper00061619 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | Worms more resistant to both Bt strains tested (Bt247 and Bt679). | Paper_evidence | WBPaper00061619 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Treatment | Worms grown on spores derived from the pathogenic Bacillus thuringiensis (Bt) strain MYBt18247 (Bt247) and MYBt18679 (Bt679) in separate experiments. Fourth-instar larvae (L4) were transferred onto 6 cm diameter inoculated with 75 or 100 ul of different concentrations of Bt spore solutions. | Paper_evidence | WBPaper00061619 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| WBPhenotype:0001507 | Paper_evidence | WBPaper00061619 | ||||||
| Curator_confirmed | WBPerson557 | |||||||
| Remark | Worms more resistant to both Bt strains tested (Bt247 and Bt679). | Paper_evidence | WBPaper00061619 | |||||
| Curator_confirmed | WBPerson557 | |||||||
| Phenotype_assay | Treatment | Worms grown on spores derived from the pathogenic Bacillus thuringiensis (Bt) strain MYBt18247 (Bt247) and MYBt18679 (Bt679) in separate experiments. Fourth-instar larvae (L4) were transferred onto 6 cm diameter inoculated with 75 or 100 ul of different concentrations of Bt spore solutions. | Paper_evidence | WBPaper00061619 | ||||
| Curator_confirmed | WBPerson557 | |||||||
| Location | CGC | |||||||
| Remark | Deletion breakpoints are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | Inferred_automatically | From CGC strain data | |||||
| Made_by: Horvitz Lab | CGC_data_submission | |||||||
| WBStrain mapped, WBPaper00061619 added based on AFP_Strain data. | Curator_confirmed | WBPerson1983 | ||||||
| Reference | WBPaper00061619 | |||||||
| Species | Caenorhabditis elegans |
