WormBase Tree Display for Strain: WBStrain00022439
expand all nodes | collapse all nodes | view schema
| WBStrain00022439 | Status | Live | ||
|---|---|---|---|---|
| Genotype | nos-2(ax2033) II. | |||
| Public_name | JH3180 | |||
| Contains | Gene | WBGene00003784 | ||
| Variation | WBVar02141330 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 11 Nov 2014 00:00:00 | |||
| Location | CGC | |||
| Remark | Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23. | Inferred_automatically | From CGC strain data | |
| Made_by: Chih-Yung Lee | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
