About
WormBase is an international consortium of biologists and computer scientists [Read more]
General
People
What's New
Want to know more about worm research?
Directory
Start here to access information about the species and data available at WormBase [Read more]
Get Started
Search
Browse
Tools
Latest updates
Need help?
Explore WormBase with a variety of search and analytical tools [Read more]
General Search
By Sequence
By Object
By Literature
By Expression
Data Mining and Batch Queries
For Parasites
For Developers
By Ontology
Top 3 most used tools
Downloads
Access precomputed data files to facilitate downstream analysis [Read more]
Download
Commonly requested data
Community
Explore online resources supporting the C. elegans research community [Read more]
Directories
Get Involved
Resources
External links
Support
We've created different user guides for distinct interests and experience levels [Read more]
For developers
Still have questions?
Citing WormBase
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
This read diverges at this point and then joins again later, think this is a retracking problem but do not use for finishing & try again.
Appauling read, can't tell if it diverges or is just bad quality, do not use for finishing
Reading cut off before this point - probably a retracking problem, not a repeat problem
Reading cut off before this point, probably due to retracking problem not repeat problem
serial#=f32a11.1 template=tm87e10.s1at sequence=AAATTAGACGGTTGGGC flags=
serial#=f32a11.2 sequence=CGGCAATTCTACAAAATG flags=
serial#=F32A11.10 template=tm55b5 sequence=GCTCAAAGTTTTGGAAAAAATG flags=
serial#=f32a11.9 template=tf39e9.s1tb sequence=TGGATGTAAAGAGGGCG flags=
serial#=f32a11.5 template=tm87g12.s1at sequence=CACTGTGTGCATAAATCG flags=
serial#=f32a11.3 sequence=CTTTAAATGTACCTTAACCG flags=
serial#=f32a11.8 template=tm87d8.s2ta sequence=GAATTTCGCAACAAAACTG flags=
serial#=f32a11.6 template=tm87d8.s2tf sequence=ACATTCAACCCAGTTGC flags=
serial#=f32a11.4 sequence=GCTAATTCACAGTTTTATGC flags=
serial#=f32a11.7 template=tf39c2.s1t sequence=CGAGCCTGAAATCAGTG flags=
No primer read but is double stranded ??Have tried to get primer across??