WormBase Tree Display for RNAi: WBRNAi00115993
expand all nodes | collapse all nodes | view schema
| WBRNAi00115993 | Homol | Homol_homol | Y41C4A:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | CAGATCGCACATTTACCTCGACGCCGAGGAATCTCACTCGGTTATGGAGCTCAAGCTAATGCTCGCCGGAATCACACGGGACCCAGTCAATCATATGGAGCTGTGGAAACTCGACGAGGACGGCAACAAAAGCCAGCTACTTCACGACACCGCCACGCTTTCTGACGCCGGCTTCTCGTCGACTAATGCCAAGGCCCAATGCCCAGCGGCTCTCGGACTCCGACTCACCAACGCCGAGGAGCATCTCACGATCAGCGACGTCTCCACTGCTCCACCAATTCCAGA | |||
| Experiment | Delivered_by | Injection | |||
| Inhibits | Predicted_gene | Y41C4A.10 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001235 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y41C4A.10.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00026616 | ||||
| Phenotype | WBPhenotype:0001152 | Remark | The time needed for the pronuclear migration and the first mitotic segregation was about 1.5-fold longer in these embryos. In addition to injection of RNAi, the authors also feed RNAi. | ||
| Remark | In addition to injection of RNAi, the authors also feed RNAi. | ||||
| Method | RNAi |
