WormBase Tree Display for RNAi: WBRNAi00098801
expand all nodes | collapse all nodes | view schema
| WBRNAi00098801 | Homol | Homol_homol | K04G2:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | AAGATTTCGCGAAGATACGGCGATCGAGGTTGACGATGCTATAACAGTTCTTCTTTCATCTCTACATTTCGAACACAAACGTGATATTGTTCCGACCGATGAAGATGATAATAAACTTCGAGAACTTCACGAAAAGATTTTTGCATTGATAACGAGTGAATCTGATGTTAACAGAAAAAGACGGCTGAAAAAAGCTCTTCCTGCGTCAAACTGTGTTAGAGAACAAGTATATTATCTTCGAAGGAAACCATCAACACCACCAGCTTCTTATTATCATCGACTAAATGCAGCTCTTCACACAATCGTTAAGGAATCATTTGGAGAAGAATATCGAAAAGTTGCTACAGTATTAGGACTTGT | ||||
| Experiment | Laboratory | EU | ||||
| Date | 08 Jun 1999 00:00:00 | |||||
| Treatment | RNA was injected at concentrations between 1 and 5 micrograms per milliliter into wild-type hermaphrodites. After 24 hours, injected hermaphrodites were singled out and mated with wild-type males to increase the number of progeny. 12 to 24 hours later, hermaphrodites laying embryos with the appropriate phenotype were used to isolate early embryos. | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | K04G2.8c | Inferred_automatically | RNAi_primary | ||
| K04G2.8b | Inferred_automatically | RNAi_primary | ||||
| K04G2.8a | Inferred_automatically | RNAi_primary | ||||
| Gene | WBGene00000156 | Inferred_automatically | RNAi_primary | |||
| Transcript | K04G2.8c.1 | Inferred_automatically | RNAi_primary | |||
| K04G2.8b.1 | Inferred_automatically | RNAi_primary | ||||
| K04G2.8a.1 | Inferred_automatically | RNAi_primary | ||||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00003645 | |||||
| Phenotype_not_observed | WBPhenotype:0000760 | Remark | apr-1 RNAi did not affect EMS spindle orientation | |||
| EQ_annotations | Anatomy_term | WBbt:0006876 | PATO:0000460 | |||
| Remark | (Figure 2) apr-1 RNAi. apr-1 cDNA sequence corresponding to sequenced portion of clone yk40c12 used for curation. | |||||
| Method | RNAi |
