WormBase Tree Display for RNAi: WBRNAi00098801
expand all nodes | collapse all nodes | view schema
WBRNAi00098801 | Homol | Homol_homol | K04G2:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | AAGATTTCGCGAAGATACGGCGATCGAGGTTGACGATGCTATAACAGTTCTTCTTTCATCTCTACATTTCGAACACAAACGTGATATTGTTCCGACCGATGAAGATGATAATAAACTTCGAGAACTTCACGAAAAGATTTTTGCATTGATAACGAGTGAATCTGATGTTAACAGAAAAAGACGGCTGAAAAAAGCTCTTCCTGCGTCAAACTGTGTTAGAGAACAAGTATATTATCTTCGAAGGAAACCATCAACACCACCAGCTTCTTATTATCATCGACTAAATGCAGCTCTTCACACAATCGTTAAGGAATCATTTGGAGAAGAATATCGAAAAGTTGCTACAGTATTAGGACTTGT | ||||
Experiment | Laboratory | EU | ||||
Date | 08 Jun 1999 00:00:00 | |||||
Treatment | RNA was injected at concentrations between 1 and 5 micrograms per milliliter into wild-type hermaphrodites. After 24 hours, injected hermaphrodites were singled out and mated with wild-type males to increase the number of progeny. 12 to 24 hours later, hermaphrodites laying embryos with the appropriate phenotype were used to isolate early embryos. | |||||
Delivered_by | Injection | |||||
Inhibits | Predicted_gene | K04G2.8c | Inferred_automatically | RNAi_primary | ||
K04G2.8b | Inferred_automatically | RNAi_primary | ||||
K04G2.8a | Inferred_automatically | RNAi_primary | ||||
Gene | WBGene00000156 | Inferred_automatically | RNAi_primary | |||
Transcript | K04G2.8c.1 | Inferred_automatically | RNAi_primary | |||
K04G2.8b.1 | Inferred_automatically | RNAi_primary | ||||
K04G2.8a.1 | Inferred_automatically | RNAi_primary | ||||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00003645 | |||||
Phenotype_not_observed | WBPhenotype:0000760 | Remark | apr-1 RNAi did not affect EMS spindle orientation | |||
EQ_annotations | Anatomy_term | WBbt:0006876 | PATO:0000460 | |||
Remark | (Figure 2) apr-1 RNAi. apr-1 cDNA sequence corresponding to sequenced portion of clone yk40c12 used for curation. | |||||
Method | RNAi |