WormBase Tree Display for RNAi: WBRNAi00097409

WBRNAi00097409 Homol: Homol_homol: M110:RNAi
  Sequence_info: DNA_text: GGTCTTCAACTCATCGAGACTGTAGGCGTGATGTTGGATAAATCAAAAGATTCCACGACCGTATTCCTTGATCAATGGTTCCAGAAGTTGGAAGCTGCCAAACCTTACTGCTCAAACAAAATCCGTTTCATGATCATGAATCTTATGGAGCTTCGCAAAGACAAATGGATTCCAAGAAAATCTACCGAGTCTGGACCGAAAAAAATCGATGAAATTCACAAAGATATTCGTCAAGAGAAGATTGAAAATGAGAAAGCTCGTGATCAATATGATCGGGATCGTGATCGTCGTCATGGAGGTGTCAGACCAAACAGCAACTCTCTCAGAAAATCAGTTCCAGTCTCCAGGAATTCATTGGATAGGAACCGAGGAATGCAACACCCTGAACAAAAAAGAGCCGCTGCTGCAGCTAACACAAAACTTGCCTCATCGAGTGTTCAACCCAAAAACATCTCGCTCTCTTCGATGGATAATAATACTCTTGGGAAGAGCAAAAAAGAGTGGCATTCTGGTGCTTCTGGTGGAGGAAACACTTCTTCCGAATCTGCCGTTCCAGTCAAATCAGCTTGGGGGCGACGTGATTCCAATGATCAACGCAAAAAGTCGACTGTTGACGAGAAACAGGC
  Experiment: Laboratory: KX
    Date: 06 Mar 2008 00:00:00
    Treatment: Synchronized worms were incubated at 20 degrees Celsius until L3/L4 stages just prior to formation of a pronounced gonad. Five to six P0 hermaphrodites were transferred to seeded RNAi plates containing bacteria expressing appropriate target dsRNA. Adults were allowed to feed and lay offspring (F1s) for 24-36 hours at 25 degrees Celsius before being transferred to subsequent plates.
    Delivered_by: Bacterial_feeding
  Inhibits: Predicted_gene: M110.4d Inferred_automatically: RNAi_primary
      M110.4c Inferred_automatically: RNAi_primary
      M110.4e Inferred_automatically: RNAi_primary
      M110.4b Inferred_automatically: RNAi_primary
      M110.4a Inferred_automatically: RNAi_primary
    Gene: WBGene00002066 Inferred_automatically: RNAi_primary
    Transcript: M110.4c.1 Inferred_automatically: RNAi_primary
      M110.4e.1 Inferred_automatically: RNAi_primary
      M110.4b.1 Inferred_automatically: RNAi_primary
      M110.4d.1 Inferred_automatically: RNAi_primary
      M110.4a.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00031847
  Phenotype: WBPhenotype:0000050 Remark: ifg-1 RNAi using construct C2 resulted in no embryos nor any evidence of unfertilized oocytes in the uterus. C2 (RNAi) resulted in two populations of worms. In one population, body size and gonad development was consistent with the larval L2 stage. The other population contained an extended U-shaped gonad consistent with an adult germline despite the small L3-like body size. All ifg-1(RNAi) worms displayed marked deterioration in the proximal gonad.
    WBPhenotype:0000154 Remark: ifg-1 RNAi using construct C2 resulted in no embryos nor any evidence of unfertilized oocytes in the uterus. C2 (RNAi) resulted in two populations of worms. In one population, body size and gonad development was consistent with the larval L2 stage. The other population contained an extended U-shaped gonad consistent with an adult germline despite the small L3-like body size. All ifg-1(RNAi) worms displayed marked deterioration in the proximal gonad.
    WBPhenotype:0000229 Remark: ifg-1 RNAi using construct C2 resulted in no embryos nor any evidence of unfertilized oocytes in the uterus. C2 (RNAi) resulted in two populations of worms. In one population, body size and gonad development was consistent with the larval L2 stage. The other population contained an extended U-shaped gonad consistent with an adult germline despite the small L3-like body size. All ifg-1(RNAi) worms displayed marked deterioration in the proximal gonad.
    WBPhenotype:0000691 Remark: ifg-1 RNAi using construct C2 resulted in no embryos nor any evidence of unfertilized oocytes in the uterus. C2 (RNAi) resulted in two populations of worms. In one population, body size and gonad development was consistent with the larval L2 stage. The other population contained an extended U-shaped gonad consistent with an adult germline despite the small L3-like body size. All ifg-1(RNAi) worms displayed marked deterioration in the proximal gonad.
    WBPhenotype:0001958 Remark: ifg-1 RNAi using construct C2 resulted in no embryos nor any evidence of unfertilized oocytes in the uterus. C2 (RNAi) resulted in two populations of worms. In one population, body size and gonad development was consistent with the larval L2 stage. The other population contained an extended U-shaped gonad consistent with an adult germline despite the small L3-like body size. All ifg-1(RNAi) worms displayed marked deterioration in the proximal gonad.
  Remark: (Figure 4b, 4c) ifg-1 RNAi (construct C2)
  Method: RNAi