WormBase Tree Display for RNAi: WBRNAi00092769

WBRNAi00092769 Homol: Homol_homol: W10C8:RNAi
  Sequence_info: DNA_text: ATGATGGCCGACGAAGAGCTCGGCGATGAGGTGAAGGTGTTCCGTCGGGATGAGGATGCTGACGATGATCCAATGATTAGTGGTGAAACGTCAGAACAACAGTTAGCCGATGATAAAAAAGAAGCTGTAATGGAAGCAGAATTAGACGGTGCCGGTCGAAATCCATCGATTGATGTGTTAAAAAGTGCATTTCCAAAAGTCGAACCAATGTCACCATCGTTTCCCGGTTTAATGTCACACTTCAGTCCTGGATACTCGGCAGCTGCTTTACCCATGTTTATGCCTCTATTTATGAATCCATACGCAGCAGCACTACGATCACCAAGCCTGATGTTTCCAATGGGAGCAATGAGCCCCACATTTCCAATGTTCCCGCCAAGTCCTGTCTATGGAGCAGCAATCGCTGCGGCAGCCGCCAAACAACACTTTGAGAATATGGCTCCACTGAACATGCGAGCCGGTCATCCAATGAATCAGATGGGAATGCCACCATACATGCATCCATCATCAATGGCTCCACAGAATGTCGATCGAAGGGCTCAAGGAGGTGGAAAAGCGAAGAAGGATGATCATGTGAAGAAGCCATTAAACGCGTTCATGTGGTTTATGAAGGAAAATCGAAAAGCACTGCTGGAAGAGATTGGAAATAATGAGAAACAGAGTGCAGAGTTGAATAAAGAGCTTGGAAAGAGGTGGCATGATTTGTCGAAGGAAGAACAGGCGAAATATTTTGAAATGGCAAAGAAGGATAAGGAAACACACAAGGAACGGTATCCGGAGTGGTCGGCGCGGGAAAATTATGCGGTTAATAAGAAAAAGACGAAGAAACGAAGGGATAAGAGTATTCCATCGGAGAACAACGATCAGAAGAAGTGCCGAGCCAGATTCGGAGTTAACAACACAGAAATGTGGTGTAAATTCTGCAAGCGGAAGAAGAAGTGCGAGTACGCAACTGATCGTTCGGGCGGTTCCGATATAACTGACAGTCAGGATGGACGAGGTACAAGTGGTGCGTATAGCAGTAGCTCGGAGAGCCCATCACCAAAGGCAAACGCTGGAATTGCACTGACCACACAGCAGCAGCAAGCAGCAATGATGCATACGATGTTGATGCAAATGCGTCTAGGATCGACGACGGGAGCATCGACGCACGTTCCATCACCACTGGCGTCCTCGTCGGCAGGCAGGAGTCCGCTGGATGCGAACGCGTCGGATTCGGAATCTGATGTTGAGGAGGAGGAAGACGAGCAGATTGATCCGACGGTTATGCAGCAGACACATGATATGCTTATGCAGGAATCGATGTGTACTATTTAA
  Experiment: Laboratory: JJ
    Date: 01 JAN 1998 00:00:00
    Genotype: glp-1(e2141); H20-GFP [neuronal marker]
    Delivered_by: Injection
  Inhibits: Predicted_gene: W10C8.2 Inferred_automatically: RNAi_primary
    Gene: WBGene00004077 Inferred_automatically: RNAi_primary
    Transcript: W10C8.2.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00002998
  Phenotype: WBPhenotype:0000097 Remark: glp-1(e2141);pop-1(RNAi) embryos had a much larger amount of hypodermal tissue than did glp-1(e2141) mutant embryos, but few if any neurons, as indicated by the lack of H20-GFP expression. The development of the first two AB daughters was analyzed individually in glp-1(e2141);pop-1(RNAi) embryos by killing all other blastomeres with a laser microbeam. Each AB daughter produced hypodermal cells almost exclusively. The lack of neurons in these experimental embryos indicates that pop-1(+) activity is required for the ABxxa fate.
    WBPhenotype:0001312 Remark: glp-1(e2141);pop-1(RNAi) embryos had a much larger amount of hypodermal tissue than did glp-1(e2141) mutant embryos, but few if any neurons, as indicated by the lack of H20-GFP expression. The development of the first two AB daughters was analyzed individually in glp-1(e2141);pop-1(RNAi) embryos by killing all other blastomeres with a laser microbeam. Each AB daughter produced hypodermal cells almost exclusively. The lack of neurons in these experimental embryos indicates that pop-1(+) activity is required for the ABxxa fate.
    WBPhenotype:0001643 Remark: glp-1(e2141);pop-1(RNAi) embryos had a much larger amount of hypodermal tissue than did glp-1(e2141) mutant embryos, but few if any neurons, as indicated by the lack of H20-GFP expression. The development of the first two AB daughters was analyzed individually in glp-1(e2141);pop-1(RNAi) embryos by killing all other blastomeres with a laser microbeam. Each AB daughter produced hypodermal cells almost exclusively. The lack of neurons in these experimental embryos indicates that pop-1(+) activity is required for the ABxxa fate.
    WBPhenotype:0008001 Remark: glp-1(e2141);pop-1(RNAi) embryos had a much larger amount of hypodermal tissue than did glp-1(e2141) mutant embryos, but few if any neurons, as indicated by the lack of H20-GFP expression. The development of the first two AB daughters was analyzed individually in glp-1(e2141);pop-1(RNAi) embryos by killing all other blastomeres with a laser microbeam. Each AB daughter produced hypodermal cells almost exclusively. The lack of neurons in these experimental embryos indicates that pop-1(+) activity is required for the ABxxa fate.
  Remark: (Figure 4, Table 2) pop-1 RNAi. Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation.
  Method: RNAi