WormBase Tree Display for RNAi: WBRNAi00092215
expand all nodes | collapse all nodes | view schema
| WBRNAi00092215 | Homol | Homol_homol | F17E9:RNAi | ||
|---|---|---|---|---|---|
| F58B3:RNAi | |||||
| Y65B4BR:RNAi | |||||
| C45G7:RNAi | |||||
| Sequence_info | DNA_text | cggactccatcccataaaaagtaaacgacaagtcataaaaattggaattcgcgtagtttgctcttccgtgaaggcaaacacacgtgctcagctatattgataagagatgaaaaacgagaggaatcagtcgaggtgtctgatctacttccaggatggtgaccgctcttctactcctattggctcttgcagccacctctttggcggctcttccagatttgggatatcccggatggcagtgcgatgcatcgctttatcagaagtaggtggcttactttaattactaaagtttgaaattttcctcgctttcaggagcaaaaataccccgacttctgcccactccgtccgattcaccgacataaaagttttgggagctctcggagactccttgaccgccgccaatggagccggagcaccaaagggagaccctctggctgtgatccttcagtacagaggactagccttccagtgtggaggtgaccactctctcgacgagcatgtcactgttgcaagtaagccatttttctggggaattgagaaaactgagttgttgtagatgtgctgaaaaagttcagccctaacctaatgggatactccactggaatcggaagtgccaacgtttgggaggtctcaaaactgaaccaagcagttccaggagctgaagcaatcgatatcatcactcaggccagagctctggtgcaaattatccaaagccacaaggaggtagccaagtccaaactaaacatcaattccgatgcatttccagattgattacaaaactgattggaagcttatcaacgtattcattggagcaaacgacatgtg | |||
| PCR_product | sjj_C45G7.3 | ||||
| sjj_F58B3.2 | |||||
| Experiment | Laboratory | JIN | |||
| Date | 29 May 2012 00:00:00 | ||||
| Genotype | eri-1(mg366) | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F58B3.2 | Inferred_automatically | RNAi_primary | |
| F58B3.3 | Inferred_automatically | RNAi_primary | |||
| Y65B4BR.1 | Inferred_automatically | RNAi_primary | |||
| C45G7.3 | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00016670 | Inferred_automatically | RNAi_primary | ||
| WBGene00003095 | Inferred_automatically | RNAi_primary | |||
| WBGene00022040 | Inferred_automatically | RNAi_primary | |||
| WBGene00003094 | Inferred_automatically | RNAi_primary | |||
| Transcript | F58B3.3.1 | Inferred_automatically | RNAi_primary | ||
| F58B3.2.1 | Inferred_automatically | RNAi_primary | |||
| Y65B4BR.1.1 | Inferred_automatically | RNAi_primary | |||
| C45G7.3.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000520130 | ||||
| Reference | WBPaper00041294 | ||||
| Phenotype | WBPhenotype:0001013 | Remark | Enhanced-RNAi mutant eri-1(mg366) animals were subjected to feeding RNAi with 3 different clones (ilys-3, Y65B4BR.1, lys-5) and subsequently transferred to Staphylococcus aureus pathogenesis assays. The S. aureus strain used was NCTC 8325. The effect of the three clones is synthetic as each individual knockdown by RNAi did not show an increase in pathogen susceptibility. | ||
| Remark | Enhanced-RNAi mutant eri-1(mg366) animals were subjected to feeding RNAi with 3 different clones (ilys-3, Y65B4BR.1, lys-5) and subsequently transferred to Staphylococcus aureus pathogenesis assays. The S. aureus strain used was NCTC 8325. The effect of the three clones is synthetic as each individual knockdown by RNAi did not show an increase in pathogen susceptibility. | ||||
| Method | RNAi |
