WormBase Tree Display for RNAi: WBRNAi00087595

WBRNAi00087595 Homol: Homol_homol: M01D7:RNAi
      Y39G8C:RNAi
  Sequence_info: DNA_text: ggtttcttcgacgcctaacaagagactttctccagtttacaagccatctccagtcccaaagaatactccaagaactacttcatcatcaagcaaaaccactatcaacacaactactactcgcattccatcaactccccggaggattacctcagtgcccgggttgatcacagacttcacgccaagcttctccacattcggaagcgatcgccccggcgctacaccgccaagaaaatcgatttacacgtcgaaagtgtccaaagttcttcacgacttgggaaacactaccggagaagaggatgatgatgacgagtttgaaggtcaagagacgagtagaatcatctacaagacagaagaaccctcgcggcggggcattgtgaagaacgcgtggaacaaggtgctcggctatggtttcgatgcgtccaagaatccaggagacagctatgatcttcgcgccggtgcctccagaatccgtgtgcagaagaatccgagaaccgggaaggtgactgtgaagcagacgaatattttcaacgaggcgatttatttcgcgctctatgtgattttaattttgttcgtcgtgcttggaatcgcctacgcgctgacaacaacgcatcgcccgaaaactgcggatttctcgggttattggggagttttgaaggcggccggccgagattcgctcaatttcttctacaattacgcgattcttccagtcgtttca
      atggacgtctcccagctgacagatgccgaactacgcgatagccttaaaagccacggggtttctgttgggccaattgtggcgacgacccgcaagctctacgagaagaagcttatcaagttatcagacggaagcattaacaatcaatcaaatctcaacgactctcaattcaacgaggattcattgatcatcagctcgtcaccgaagaaatcaccgccacaacgagttttccagaacgtgtcagctgcaacagcggcagctactacctctcccgaatcggacagcgacgattgcgaggagtcgatgcgatacttgacggaagaggaaatggccgccgatcgggcatcggctcgtcaagctcagagcaacaaaggaggattcttgggaagcacgatcacattcacaattctcttcgtcttcatcgccgtcttcgcctacttcttgatcgagaacgccgagcagttgaagctcgtggccgagacgaatccggaggatactatttaa
  Experiment: Date: 15 Apr 2003 00:00:00
    Strain: WBStrain00000001
    Delivered_by: Injection
  Inhibits: Predicted_gene: W01G7.5 Inferred_automatically: RNAi_primary
      M01D7.6 Inferred_automatically: RNAi_primary
    Gene: WBGene00002275 Inferred_automatically: RNAi_primary
      WBGene00001309 Inferred_automatically: RNAi_primary
    Transcript: M01D7.6.2 Inferred_automatically: RNAi_primary
      M01D7.6.1 Inferred_automatically: RNAi_primary
      W01G7.5.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Interaction: WBInteraction000501383
  Reference: WBPaper00005828
  Phenotype: WBPhenotype:0000050 Remark: The results were striking, with 100% embryonic lethality by the 100-cell stage in lem-2(RNAi); emr-1(RNAi) embryos laid 12 - 36 h after injection of dsRNA. Immunostaining of these dead and dying embryos showed complete loss of Ce-emerin protein and > 90% reduction of Ce-MAN1 protein. Thus, in the absence of Ce-emerin, lowering the levels of Ce-MAN1 caused a complete arrest of embryonic development. DAPI staining of double-RNAi embryos at the stages when they arrested (<100 cells) showed that more than 50% of the nuclei examined had abnormally condensed chromatin (n = 30 embryos). This condensed chromatin phenotype probably was not the result of anaphase chromatin bridges, because nuclei with condensed chromatin were observed even at the one-cell stage. Differential interference contrast time-lapse microscopy was used to follow the fate of nuclei and chromatin in lem-2(RNAi); emr-1(RNAi) embryos. This analysis showed that unlike loss of Ce-lamin, which destabilizes nuclear shape, the loss of both Ce-emerin and Ce-MAN1 did not affect nuclear shape. Thus, at least some lamina functions were still normal. Microtubule patterns as determined by immunof luorescence also appeared normal. The most striking phenotype in lem-2(RNAi); emr-1(RNAi) embryos was anaphase chromatin bridges, which were present as early as the first nuclear divisions. The differential interference contrast time-lapse analysis showed that these anaphase bridges eventually were torn apart; the resulting daughter cells then progressed into the next cell cycle and formed more anaphase bridges.
    WBPhenotype:0000773 Remark: In wild-type and lem-2(RNAi) interphase cells, Ce-BAF staining was enriched near the peripheral lamins. However in lem-2(RNAi); emr-1(RNAi) embryos, Ce-BAF had an abnormally even distribution on the segregated chromatin but was undetectable on the anaphase-bridged chromatin.
    WBPhenotype:0001361
  Phenotype_not_observed: WBPhenotype:0001028
  Method: RNAi