WormBase Tree Display for RNAi: WBRNAi00087591
expand all nodes | collapse all nodes | view schema
WBRNAi00087591 | Homol | Homol_homol | M01D7:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atggacgtctcccagctgacagatgccgaactacgcgatagccttaaaagccacggggtttctgttgggccaattgtggcgacgacccgcaagctctacgagaagaagcttatcaagttatcagacggaagcattaacaatcaatcaaatctcaacgactctcaattcaacgaggattcattgatcatcagctcgtcaccgaagaaatcaccgccacaacgagttttccagaacgtgtcagctgcaacagcggcagctactacctctcccgaatcggacagcgacgattgcgaggagtcgatgcgatacttgacggaagaggaaatggccgccgatcgggcatcggctcgtcaagctcagagcaacaaaggaggattcttgggaagcacgatcacattcacaattctcttcgtcttcatcgccgtcttcgcctacttcttgatcgagaacgccgagcagttgaagctcgtggccgagacgaatccggaggatactatttaa | |||
Experiment | Date | 01 Mar 2002 00:00:00 | |||
Strain | WBStrain00000001 | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | M01D7.6 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00001309 | Inferred_automatically | RNAi_primary | ||
Transcript | M01D7.6.2 | Inferred_automatically | RNAi_primary | ||
M01D7.6.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005158 | ||||
Phenotype_not_observed | WBPhenotype:0000961 | Remark | Ce-lamin localized normally in the absence of Ce-emerin. Both Ce-MAN1 and UNC-84 were localized at the nuclear envelope in emr-1(RNAi) embryos, as were nuclear pore complexes detected using monoclonal antibody mAb414. Thus, of the nuclear proteins tested (Ce-lamin, Ce-MAN1, UNC-84 and nucleoporins), none depended on Ce-emerin. | ||
Method | RNAi |