WormBase Tree Display for RNAi: WBRNAi00087549
expand all nodes | collapse all nodes | view schema
| WBRNAi00087549 | Homol | Homol_homol | C14A4:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggccggcagacttcgtgaaatgcgttgtgagctctcgttcctcaaaaacgcggatggctcggcatgcttctcccagggtgccacgtgtatttgggcttcatgcagtggtcctggagatgttcacgcttcgaaagcaagtgatgaggctatgactctggatattagttatagagcaaattgtggagataacaagttcaatgtgctgaacaatatcattcattctactctatccaatgcaatcaatctcgaattgtttccccacacaacaatttctgtcacagtacatggaattcaggatgatggaagtatgggagctgtagcgataaatggagcttgttttgctctacttgacaatggaatgccattcgaaacagtcttctgtggtgtccttattgttcgtgtcaaagatgagctgattattgatccgacagcaaaacaagaagctgcatcgactggaagagtgctcttttcagtgtgcaaaggatccgatggacatccagaagtgtgtgcgatggacgctataggacattgggattttattcagctggaagccgcgtggtcattggcacaaccatctgccagtgctatttttgatttctacaaaactgtgatgaagaggaagctttcggttgatgagcaatag | |||
| Experiment | Date | 01 Apr 2003 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C14A4.5 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000798 | Inferred_automatically | RNAi_primary | ||
| Transcript | C14A4.5.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005857 | ||||
| Phenotype | WBPhenotype:0000730 | Remark | Higher number of TUNEL-positive nuclei. The peak of embryonic cell corpses was shifted from the bean/comma stage in control(RNAi) animals to the 2-fold stage in these RNAi-treated animals. | ||
| Method | RNAi |
