WormBase Tree Display for RNAi: WBRNAi00087300
expand all nodes | collapse all nodes | view schema
| WBRNAi00087300 | Homol | Homol_homol | F10D2:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ctcaatacctgttcatggatccaaatgaagtcctgcaagtccaagaggagagcaaaaaaattccatacaaaatggaaatagtgtggcgtaacgtggctctctttgctgctctgcacgtcgccgcagccattggactttacgagcttgtcttccatgctaaatggcaaacggccgtcttctcatttgctctctatgtgttctcaggattcggtatcacagctggagcccatcgtctctggtctcataaatcatacaaggcaaccacaccaatgagaatctttttgatgctcttgaacaacattgctcttcaaaacgacatcattgaatgggctcgtgatcatcgttgccatcacaagtggactgatacagatgctg | |||
| Experiment | Date | 02 Apr 2008 00:00:00 | |||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F10D2.9 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001399 | Inferred_automatically | RNAi_primary | ||
| Transcript | F10D2.9.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000517803 | ||||
| WBInteraction000517804 | |||||
| Reference | WBPaper00031804 | ||||
| Phenotype | WBPhenotype:0000136 | Remark | mRNA levels of acs-2 and ech-1 increased substantially upon fat-7(RNAi), as determined by RT-PCR | ||
| WBPhenotype:0000640 | Remark | Authors recorded an average ovipositional delay of several hours | |||
| Phenotype_not_observed | WBPhenotype:0000114 | Remark | mRNA levels of sod-3 and daf-16 did not change upon fat-7(RNAi), as determined by RT-PCR | ||
| WBPhenotype:0000351 | Remark | Animals exhibited wild type hatching rates | |||
| WBPhenotype:0001905 | |||||
| Method | RNAi |
