WormBase Tree Display for RNAi: WBRNAi00087284
expand all nodes | collapse all nodes | view schema
| WBRNAi00087284 | Homol | Homol_homol | W08D2:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | acaagaatgcctccgggcttcgaatgaaggtcgatggcaaatggctctaccttagcgaggaattggtgaagaaacatccaggaggagctgttattgaacaatatagaaattcggatgctactcatattttccacgctttccacgaaggatcttctcaggcttataagcaacttgaccttctgaaaaagcacggagagcacgatgaattccttgagaaacaattggaaaagagacttgacaaagttgatatcaatgtatcagcatatgatgtcagtgttgcacaagaaaagaaaatggttgaatcattcgaaaaactacgacagaagcttcatgatgatggatt | |||
| Experiment | Date | 02 Apr 2008 00:00:00 | |||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | W08D2.4a | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001395 | Inferred_automatically | RNAi_primary | ||
| Transcript | W08D2.4a.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000517798 | ||||
| Reference | WBPaper00031804 | ||||
| Phenotype_not_observed | WBPhenotype:0000114 | Remark | mRNA levels of sod-3 and daf-16 did not change upon fat-3(RNAi), as determined by RT-PCR | ||
| Method | RNAi |
