WormBase Tree Display for RNAi: WBRNAi00086854
expand all nodes | collapse all nodes | view schema
WBRNAi00086854 | Homol | Homol_homol | K03D3:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atgcaagcaatcaaatgtgtcgtcgttggtgacggagccgtcggtaagacgtgtctcctgctatcgtacactacaaacgcttttcccggagaatatattctaacggtattcgacacctactcaacaaatgtgatggtcgacggaaggccaataaatctcagcctatgggacacagctggacaggacgattacgatcaattccgccacctgtcatttccacaaacagacgtattcctcgtatgctttgcactgaataatccagcaagttttgagaatgttcgtgcaaaatggtatccagaagtatcacatcattgcccaaatacaccgattattttggttggaactaaagctgatttacgcgaggatcgagatactattgaacggctccgtgaacgtcggctccaaccagtgagccacacccagggttacgtgatggcaaaggaaatcaaggcggtcaagtacctggaatgctcggcgcttacccaaattggattgaaacaagttttcgatgaggcaattcgtactgggctcaccccgccacaaacaccacaaacgagagccaaaaagagcaattgcacggtgctttaa | |||
Experiment | Laboratory | LE | |||
Date | 01 Feb 2003 00:00:00 | ||||
Genotype | unc-73(e936) | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | K03D3.10 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004287 | Inferred_automatically | RNAi_primary | ||
Transcript | K03D3.10.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000501032 | ||||
Reference | WBPaper00005607 | ||||
Phenotype | WBPhenotype:0000384 | Remark | Axon guidance defects (the axons failed to reach the VNC and often wandered along the lateral body wall), premature axon termination and defasciculation in the ventral nerve cord, ectopic axon formation (ectopic axons formed as branches from the main axon or emanated from the cell body). | ||
WBPhenotype:0000632 | |||||
WBPhenotype:0000880 | |||||
WBPhenotype:0002490 | |||||
Remark | paper remark: Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
Method | RNAi |