WormBase Tree Display for RNAi: WBRNAi00086843
expand all nodes | collapse all nodes | view schema
WBRNAi00086843 | Homol | Homol_homol | F19G12:RNAi | ||
---|---|---|---|---|---|
Y73F8A:RNAi | |||||
Y105C5A:RNAi | |||||
AC3:RNAi | |||||
Sequence_info | DNA_text | tctggaagcttcagtctcccaatctgcacaatgtgaaccacaatgccagcaatcatgccaacagcaatgcgttcagcagcaacaaccaatgcaacaatgtgctccagcttgcacccaatcttgctctcaatcctgttctgctgctcaaccagcccagatgccatgccagacacaatcagtcaactcctgctcgtgccagcaaaactattctccatgtggaaatggacagtgttgcaagagaaagtag | |||
Experiment | Laboratory | SJ | |||
Date | 19 Aug 2002 00:00:00 | ||||
Genotype | [ire-1(zc14)II] | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | AC3.4 | Inferred_automatically | RNAi_primary | |
AC3.3 | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00000024 | Inferred_automatically | RNAi_primary | ||
WBGene00004098 | Inferred_automatically | RNAi_primary | |||
Transcript | AC3.4.1 | Inferred_automatically | RNAi_primary | ||
AC3.3.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000501024 | ||||
Reference | WBPaper00005432 | ||||
Phenotype | WBPhenotype:0001003 | Remark | ~40% live animals comparing to no RNAi control | ||
Penetrance | Incomplete | ||||
Remark | Nucleotides 1032-1278 of abu-1 cDNA (WS227). | ||||
Method | RNAi |