WormBase Tree Display for RNAi: WBRNAi00086823
expand all nodes | collapse all nodes | view schema
| WBRNAi00086823 | Homol | Homol_homol (11) | |||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggctcgtactaagcaaaccgcccgtaaatcgaccggaggaaaggctccaagaaagcaattggccaccaaggctgcccgtaaatcggctccagcttccggaggtgtcaagaagccacatcgttatcgtccaggaaccgtcgctctacgtgagatcagacgttaccagaaatccaccgagcttctcattcgtagagcgccattccagcgtcttgtccgtgagattgctcaggatttcaagaccgatctccgattccagtcttcagctgttatggctcttcaagaggccgccgaggcttacctcgtcggacttttcgaggataccaacttgtgtgccatccatgctaagcgagttaccattatgccaaaggacatccaattggcaagacgtatccgaggagagcgtgcttaa | |||
| atgtccggacgtggaaagggaggaaaaggccttggaaaaggaggagccaagcgtcatcgcaaagtgcttcgtgataacatccaaggtatcaccaagccggcaattcgtcgtctcgccagaagaggtggagtcaagagaatctctggactcatctacgaggaaacccgtggagtcctcaaggtgttccttgagaatgtgatccgtgatgccgtcacatactgcgagcacgccaagagaaagaccgtcactgccatggatgttgtctatgccttgaagcgtcaaggaagaaccctgtacggattcggaggataa | |||||
| Experiment | Date | 15 Feb 2002 00:00:00 | |||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F08G2.3 | Inferred_automatically | RNAi_primary | |
| ZK131.8 | Inferred_automatically | RNAi_primary | |||
| ZK131.4 | Inferred_automatically | RNAi_primary | |||
| ZK131.1 | Inferred_automatically | RNAi_primary | |||
| ZK131.2 | Inferred_automatically | RNAi_primary | |||
| ZK131.7 | Inferred_automatically | RNAi_primary | |||
| ZK131.3 | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001899 | Inferred_automatically | RNAi_primary | ||
| WBGene00001884 | Inferred_automatically | RNAi_primary | |||
| WBGene00001888 | Inferred_automatically | RNAi_primary | |||
| WBGene00001883 | Inferred_automatically | RNAi_primary | |||
| WBGene00001916 | Inferred_automatically | RNAi_primary | |||
| WBGene00001887 | Inferred_automatically | RNAi_primary | |||
| WBGene00001900 | Inferred_automatically | RNAi_primary | |||
| Transcript | ZK131.7.1 | Inferred_automatically | RNAi_primary | ||
| ZK131.4.1 | Inferred_automatically | RNAi_primary | |||
| ZK131.8.1 | Inferred_automatically | RNAi_primary | |||
| F08G2.3.1 | Inferred_automatically | RNAi_primary | |||
| ZK131.3.1 | Inferred_automatically | RNAi_primary | |||
| ZK131.2.1 | Inferred_automatically | RNAi_primary | |||
| ZK131.1.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005142 | ||||
| Phenotype | WBPhenotype:0000361 | Penetrance | Complete | ||
| WBPhenotype:0000688 | Penetrance | Complete | |||
| Remark | paper remark: Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. Authors mentioned that full-length cDNA was used. Both injection and feeding led to the same phenotype. | ||||
| Method | RNAi |
