WormBase Tree Display for RNAi: WBRNAi00086795
expand all nodes | collapse all nodes | view schema
WBRNAi00086795 | Homol | Homol_homol | C42D4:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atggtaaagtctccaaaatccagtaaaaaggctgcagcgagagcggcaaaagcccgtgaaactgctgaaaccaatgcattcctggatagtatattcattttaatatcgtcagatggtgaaaaatttcaaacggatggtcattgcataaggcattcaaaagttctcatgcaagcgtcaaaatcattagaaacaccggatacaccaattcaagttgaaaaagtgcaaggagacacactgaatcgagttctggaatggtgtaataatcatcgagacgatggaaaatatgtgtcacaatgtggacctagtctacgtcttccacaatgggattttcgatggcttaaagatttggataatcaggagctagttgatttaatcaatgcgtcgaatgatctacaaatgcaacaattgatggattatgcatgcaagacagtggcaaatatggcaaaaggaaagaatcccgcacaattgagagaactttttggtattctaacagacgaagaggaagctgaacttgcacttaatgaacctggaccctcaaccgcataaaatgtgataatgtaacttaattttgtatttatattttctgtaaaacttgatttccaactgtcataatcgtttaaatgaaacgaattaagtt | |||
Experiment | Laboratory | ET | |||
Date | 19 Feb 2002 00:00:00 | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | C42D4.6 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004822 | Inferred_automatically | RNAi_primary | ||
Transcript | C42D4.6.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005129 | ||||
Phenotype_not_observed | WBPhenotype:0000081 | ||||
WBPhenotype:0000172 | Remark | none | |||
WBPhenotype:0000762 | |||||
WBPhenotype:0000779 | |||||
WBPhenotype:0000793 | |||||
WBPhenotype:0001080 | |||||
WBPhenotype:0001147 | |||||
WBPhenotype:0001946 | |||||
WBPhenotype:0002013 | |||||
Remark | paper remark: Exact sequence used for RNAi not stated by authors, genomic sequence of gene used for curation. Authors used genomic DNA as the template, with primers extended approximately 100 bp beyond the predicted 5 and 3 end of the genes. | ||||
Method | RNAi |