WormBase Tree Display for RNAi: WBRNAi00086535
expand all nodes | collapse all nodes | view schema
| WBRNAi00086535 | Homol | Homol_homol | T05A6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgtcttctgctcgtcgttgccttttcggtcgtccgacgcccgagcaacgctccaggactcgaatttggcttgaagatgctgttaagcgcatgcgccaggaagaaagccagaaatggggattcgactttgaactggagactcccctcccaagctctgctggattcgtttatgaagttattccagagaattgtgttccggagttctacagaaccaaagttctcactgtcagaaccacatgctcatcgctggacatcagctcaacgactttgactccattgagctctccgagcacatctgataaggaggagccctcgctgatggatcccaacagctcgttcgaagatgaagaggaaccgaagaagtggcaattcagagagccaccaactccacggaagaccccaacaaagcgtcagcagaagatgaccgacttcatggcagtttcccgtaagaagaattcgttgtctccaaacaagctgtctccggtgaatgtgatcttcactccaaaatctcgtcgtccaacgatcagaactcgatcttcatgctctccatactag | |||
| Experiment | Laboratory | MR | |||
| Date | 07 Aug 2006 00:00:00 | ||||
| Treatment | dsRNA was obtained by in vitro transcription reactions, annealing, and injection. Injected animals were transferred to new plates every 24 h, and the F1 progeny was examined for visible abnormalities that affected development or cell division. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T05A6.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000516 | Inferred_automatically | RNAi_primary | ||
| Transcript | T05A6.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00028464 | ||||
| Phenotype | WBPhenotype:0000867 | Remark | Authors report that RNAi of cki-1 resulted in a high frequency of embryonic arrest, although did not observe a one-cell arrest or a multipolar spindle phenotype. | ||
| Penetrance | High | ||||
| Phenotype_not_observed | WBPhenotype:0000040 | ||||
| WBPhenotype:0001102 | |||||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
