WormBase Tree Display for RNAi: WBRNAi00085017
expand all nodes | collapse all nodes | view schema
| WBRNAi00085017 | Homol | Homol_homol | Y105E8B:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gaattggtgcacgagaaggaacgctacaagaccatctccgaagaactcgattccaccttccaagagctctccggatattaaacatccatgtcctatcgcgttccttttttccccccgcctacttgtattttcgtcacaacatcttatcccccccacccaaaaacctttgaaaccatcaaaaccactcaaactttcctattttctttacttttttaaatacttttttataaaagcttcacattatcaactgtttttctctgtgtattcatccccacccctcccatccaaaaaccaagaattctcttttagcagatgagaagcttcaattgttcttttttctttctctctcatgcaaatgttcttcgtttacaagagccggcagc | |||
| Experiment | Laboratory | ON | |||
| Date | 24 Mar 2004 00:00:00 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y105E8B.1n | Inferred_automatically | RNAi_primary | |
| Y105E8B.1r | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1q | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1m | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1p | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1a | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1k | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1o | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1s | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1l | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002978 | Inferred_automatically | RNAi_primary | ||
| Transcript (16) | |||||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00013408 | ||||
| Phenotype | WBPhenotype:0000273 | ||||
| WBPhenotype:0000666 | Remark | No ovulation. Neither intense contraction of the myoepithelial sheath nor dilation of the spermatheca took place. | |||
| WBPhenotype:0000668 | Penetrance | Complete | |||
| Range | 100 | ||||
| WBPhenotype:0000688 | Penetrance | Complete | |||
| Range | 100 | ||||
| WBPhenotype:0000979 | Remark | Neither intense contraction of the myoepithelial sheath nor dilation of the spermatheca took place. | |||
| WBPhenotype:0001018 | Penetrance | Complete | |||
| Range | 100 | ||||
| WBPhenotype:0001199 | Remark | Neither intense contraction of the myoepithelial sheath nor dilation of the spermatheca took place. | |||
| WBPhenotype:0001260 | Remark | Visualization of the actin filaments revealed that the endomitotic oocytes had irregular cell compartments and that some cells were anuclear. | |||
| Phenotype_not_observed | WBPhenotype:0000105 | Remark | Maturation was characterized by nuclear envelope breakdown. | ||
| Method | RNAi |
