WormBase Tree Display for RNAi: WBRNAi00082867
expand all nodes | collapse all nodes | view schema
| WBRNAi00082867 | Homol | Homol_homol | CHROMOSOME_II:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgctctccactattctacgaaacaattttgtacgtcgctcattttcgtcccggattttcagtcaaaatgagtacgaaacagcagctgattcaacattagaaagattatcagactatttcgatcaaattgccgattcatttccggtttccgaacaatttgatgtatctcatgcaatgggagttttgactgttaatgtatcgaaatctgttggaacgtatgttattaacaaacaatcaccaaataagcaaatttggttgtccagtccgatgtctggtccgaaaagatatgatttagaagaggagggaaaatggacttatgcacacgatggtgaacaacttgactcgcttctaaacagagaattccgaaagattctggccgatgaccgaatcgatttctcgcgacatgtctaa | |||
| Experiment | Laboratory | FP | |||
| Date | 29 Dec 2009 00:00:00 | ||||
| Temperature | 20 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F59G1.7 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001486 | Inferred_automatically | RNAi_primary | ||
| Transcript | F59G1.7.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00035867 | ||||
| Phenotype | WBPhenotype:0000154 | Remark | Reduced number of eggs within the worm. | ||
| WBPhenotype:0000164 | |||||
| WBPhenotype:0001261 | |||||
| Remark | The phenotypes associated with this experiment are improved with the addition of flavin adenine dinucleotide (FAD) or flavin mononucleotide (FMN). | ||||
| Method | RNAi |
