WormBase Tree Display for RNAi: WBRNAi00078430

WBRNAi00078430 Homol: Homol_homol: Y71H2AM:RNAi
  Sequence_info: DNA_text: tatgagaagtggaggcggataccgtggacgtggtggacgtggaaatggacaacgcttcggaggtcgcgatcaccgttatcaaggtggaagtggaaacggcggaggcggcaacggaggcggcggtggcttcggaggcggtggacaacgttccggtggaggcggtggattccagtcaggcggtggtggaggtcgccaacagcaacaacagcaacgtgctcagcctcaacaggattggtggagttaa
  Experiment: Laboratory: TR
    Date: 02 Apr 2009 00:00:00
    Strain: WBStrain00000001
    Treatment: Animals were moved to a new plate each day for 3 days, and their offspring subsequently scored each day.
    Temperature: 20
    Delivered_by: Bacterial_feeding
  Inhibits: Predicted_gene: Y71H2AM.19 Inferred_automatically: RNAi_primary
    Gene: WBGene00002244 Inferred_automatically: RNAi_primary
    Transcript: Y71H2AM.19.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00033079
  Phenotype: WBPhenotype:0000050 Remark: Authors checked the phenotypes of offspring on various days post-RNAi treatment. The highest percentage displaying this phenotype was 88 percent on day 3.
    WBPhenotype:0000682 Remark: Authors checked the phenotypes of offspring on various days post-RNAi treatment. The highest percentage displaying this phenotype was 12 percent on day 2.
  Method: RNAi