WormBase Tree Display for RNAi: WBRNAi00077802
expand all nodes | collapse all nodes | view schema
| WBRNAi00077802 | Homol | Homol_homol | Y102A5C:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggaagactcgtacaacgacatggaagaccccggcttccgccaattatctgacatggagcttcaaaaagcgctggaaatgaccaaacagagctcgataaagaacaatttgatgctcgggctcgacaatgagcttgactttgattttgatttcgacgaggatgaggacctggatcaaccacaaatgggcacacgagccgataaatcgttgggattgttggcgaaacgatttattcgaatgattcagtactcaccgtatggaagatgcgatttgaacactgccgccgaggcgctcaatgtccggcaaaagcgacgaatctacgatattacgaatgttctcgaaggaattggtcttattgagaaaagaagcaagaatatgatacagtggaaaggcggtgattttatgctaaacgtgaaggaagggaaacgacaatcggccacaacagaagaagaagatcgaatggaacaattaaaagctgaaattgagcaattaaataaggaagaagagctcattgagcaacgtcaaagatggcttcagcagagcctccgaaacatgacagaatccgtggagaacaacaagctcagctatgtgctccgttcacagctcgccgagattcaaggctcagatcttacgattggaattcaaacgagagtcggcacacaagttcggctcagtgatccggagcaagtcgagatacacggtggaccatcttggtgttacctgaaagatccctctggacccctccgagccgccatcgtttccaaccatgagctacatgattttgtacagagagaacgagcaaaacggcctggtgaagagcacgttgacgctgatgctccagatgaaatgatggatgattcaagatatcggaatcggcggacgatcaatgatgatgaaatgtttggttttgagcagaaagtcccagcgatgaagcatctggagccaccaccggccagcgatgactacgtttattcgagcaccggagacgagtatcgaggagattctatagtcgatttgtacggagattaa | |||
| Experiment | Laboratory | OP | |||
| Date | 31 Dec 2007 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Treatment | Injected young adult hermaphrodites were recovered, and eggs laid for the first 16 h after recovery were discarded. Then F1 eggs were collected at 12-h intervals and cultured at the experimental temperature. F1 progeny were used at young adult stage for in situ hybridization and immunochemistry. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | Y102A5C.18 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001161 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y102A5C.18.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031554 | ||||
| Phenotype | WBPhenotype:0000134 | Remark | In severely affected gonads, in situ hybridization exhibited little to no detectable lip-1 staining. | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
