WormBase Tree Display for RNAi: WBRNAi00077612
expand all nodes | collapse all nodes | view schema
| WBRNAi00077612 | Homol | Homol_homol | T05A6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ctcactcttttcaaatgtcttctgctcgtcgttgccttttcggtcgtccgacgcccgagcaacgctccaggactcgaatttggcttgaagatgctgttaagcgcatgcgccaggaagaaagccagaaatggggattcgactttgaactggagactcccctcccaagctctgctggattcgtttatgaagttattccagagaattgtgttccggagttctacaggtaattgaattttataaatttttcatagttattttactaaacagtttcatttttcagaaccaaagttctcactgtcagaaccacatgctcatcgctggacatcagctcaacgactttgactccattgagctctccgagcacatctgataaggaggagccctcgctgatggatcccaacagctcgttcgaagatgaagaggaaccgaagaagtggcaattcagagagccaccaactccacggaagaccccaacaaagcgtcagcagaagatgaccgacttcatggcagtttcccgtaagaagaattcgttgtctccaaacaagctgtctccggtgaatgtgatcttcactccaaaatctcgtcgtccaacgatcagaactcgatcttcatgctctccatactagaggtttcattttgacttttttttgcccaattccacgggttgaatctaatcatttgattatctcctcgacagtttctgagtctctcttaattgttcaactagtcatgtttccacaaatgttttattgtttgttccaaaagccctgtgatccatgtttaggaactctg | |||
| Experiment | Laboratory | ET | |||
| Date | 27 Nov 2006 00:00:00 | ||||
| Genotype | cul-4(gk434) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T05A6.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000516 | Inferred_automatically | RNAi_primary | ||
| Transcript | T05A6.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000009241 | ||||
| Reference | WBPaper00028868 | ||||
| Phenotype | WBPhenotype:0000732 | Remark | The size of seam cell nuclei in cki-1(RNAi) cul-4(gk434) larvae was reduced approximately threefold relative to cul-4(gk434) larvae and the seam cell DNA level was reduced. This indicates that cki-1 RNAi depletion suppresses the rereplication phenotype of cul-4 mutants. Significantly, the cki-1(RNAi) cul-4(gk434) larvae still accumulated CDT-1 protein in seam cells indicating that CKI-1 is not required for the accumulation of CDT-1 and that CDT-1 accumulation is not sufficient to induce extensive rereplication. | ||
| WBPhenotype:0001567 | Remark | The size of seam cell nuclei in cki-1(RNAi) cul-4(gk434) larvae was reduced approximately threefold relative to cul-4(gk434) larvae and the seam cell DNA level was reduced. This indicates that cki-1 RNAi depletion suppresses the rereplication phenotype of cul-4 mutants. Significantly, the cki-1(RNAi) cul-4(gk434) larvae still accumulated CDT-1 protein in seam cells indicating that CKI-1 is not required for the accumulation of CDT-1 and that CDT-1 accumulation is not sufficient to induce extensive rereplication. | |||
| Method | RNAi |
