WormBase Tree Display for RNAi: WBRNAi00069901
expand all nodes | collapse all nodes | view schema
WBRNAi00069901 | Homol | Homol_homol | F39H11:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atgcaaatgggtgatcatcaaatgatgggaaaccagagaacttacgttcaaaaagtgatgcctgcacaagctggtggtgcagtatcacaaaatgccacgtatgtgcaaacggcaggaattcgaacggttcatcacgacggaaacggacagcagaggatagttcaactacccccgggagtacgtcagattcagcaaaatggtgtcggtcctgcctatgttcgccaagttcctggtggtcaaccaatgcaagtaaactttggacatccaggaacgatagcgggtcgaaatgttgcagttggtgttcaaatgcgacctgtgcaaggacataacgttcaacaaggttatcagagacagcaagtagcaaatcaaattcaacaacaaaatcgagctgtatttatggcacaaaatcagcaaggacaacaacagataagctatgcgcaagcacaacatcgacaacaacaacagaatcaacaacaacaccaccagcaaccacaacattttaatcatccttctcaacaaaatcaaatgattatgcaacatcgtcaaccacaaatgcaccataatcagcaacatcaaatggttcaaccacaaatgacacgtcatcagatggcccaacaccatgctcagcagccacatccgcagatttatgtgccgcgtgacatgaatttggcagtgccactgagagaaccctcacctgagccgattcctgtcaaaattgaggttccagatgttcctccagaaggtacatcggctgccaatgaggaaccaatgccagatgat | |||
Experiment (2) | |||||
Inhibits | Predicted_gene (2) | ||||
Gene | WBGene00006577 | Inferred_automatically | RNAi_primary | ||
Transcript | F39H11.2a.1 | Inferred_automatically | RNAi_primary | ||
F39H11.2b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004352 | ||||
Phenotype | WBPhenotype:0000051 | Remark | Authors differentiate 3 classes of arrest: S1, S2 and S3. S1 embryos arrested at a very early stage (3080 cells), in which most of the markers that we tested were expressed prematurely and ectopically. S2 embryos arrested at an intermediate stage (150350 cells) with almost no detectable gene expression. S3 embryos arrested at a late stage (600800 cells) without any morphogenesis and with aberrant gene expression. | ||
WBPhenotype:0000779 | Remark | Authors differentiate 3 classes of arrest: S1, S2 and S3. S1 embryos arrested at a very early stage (3080 cells), in which most of the markers that we tested were expressed prematurely and ectopically. S2 embryos arrested at an intermediate stage (150350 cells) with almost no detectable gene expression. S3 embryos arrested at a late stage (600800 cells) without any morphogenesis and with aberrant gene expression. | |||
WBPhenotype:0001100 | Remark | Authors differentiate 3 classes of arrest: S1, S2 and S3. S1 embryos arrested at a very early stage (3080 cells), in which most of the markers that we tested were expressed prematurely and ectopically. S2 embryos arrested at an intermediate stage (150350 cells) with almost no detectable gene expression. S3 embryos arrested at a late stage (600800 cells) without any morphogenesis and with aberrant gene expression. | |||
Method | RNAi |