WormBase Tree Display for RNAi: WBRNAi00069118
expand all nodes | collapse all nodes | view schema
| WBRNAi00069118 | Homol | Homol_homol | T27F2:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggcacccgggaccaaaaaaaagtcggatatggcaaaattcacattctacaaagatcgcttgatgacattcaaaaatttcgaatatgatagagacccggatgcaaaatgcacgtctcaagcggttgctcaagccggattttactgcaccggtcctcagtctggcaaatgtgcattttgcaacaaggaacttgattttgacccagaagacgatccgtggtacgagcacacgaaacgtgatgaaccgtgcgagtttgtacggattggaaagctcgatgactcggaattaactattaacgataccgttcgtctctcacaaaccgccatgattatgactaaactctttgagcatgagatgatgataaataatttgtctaatcattcttcttctgatgctctcttcgatcagctgaaaaaagtaccgaacacagcatcgacaacaaaatctaacagccgccgcggcaaataa | |||
| Experiment | Laboratory | MT | |||
| Date | 01 Jun 2000 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T27F2.3 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000249 | Inferred_automatically | RNAi_primary | ||
| Transcript | T27F2.3.1 | Inferred_automatically | RNAi_primary | ||
| T27F2.3.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004303 | ||||
| Phenotype | WBPhenotype:0000775 | ||||
| WBPhenotype:0001145 | Remark | embryos lacked polar bodies | |||
| WBPhenotype:0001159 | Remark | maternal pronucleus polyploidy | |||
| WBPhenotype:0001343 | Remark | formation of the spindle midzone was severly compromised in fertilized oocytes | |||
| WBPhenotype:0001361 | Remark | The paternal chromosomes were always condensed while the maternal chromosomes were often not condensed. By contrast, in wild-type fertilized oocytes maternal and paternal chromosomes condense at the same time. | |||
| WBPhenotype:0001499 | |||||
| WBPhenotype:0001584 | Remark | during meiosis I | |||
| Phenotype_not_observed | WBPhenotype:0000981 | ||||
| Method | RNAi |
