WormBase Tree Display for RNAi: WBRNAi00066133
expand all nodes | collapse all nodes | view schema
| WBRNAi00066133 | Homol | Homol_homol | F58E10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggcggagttcccaaatctcggaaagcactgtgagagcacagtttgcaacagacttgattttcttccaatcaaatgctccggttgtggacatttctactgctcagagcacttcacatttgaggctcataattgtccgactggctcaagaatttccgttcaagttcctatttgtcctatatgtgagaagccagttccaacgccgaaagatgtcaatgttgatcaacaagtcaatgagcacattcagaacaattgtcagactccgaaacgtgcaaaagtatattcaaacgcgtgtaccgtcccaaaatgcaagaagaaagagctggtagccatgaattgctcaaaatgtcgaaacaactactgcctttctcacagacacgagcgggatcacagttgtgagcgaaaagttggcgaaatgaagataaatcagaaaaagagctggacggattcaatcacatcaatcgcgcgttcccgaatgaatccatgttccgcacaagcaagaacagagggagatgaagctctggctcgttctctacaacaagaagaatacaatcgagttgcaccgccgcatcaaacaagaaattccaattccaactgcaccgtctcatag | |||
| Experiment | Laboratory | SJ | |||
| Date | 24 Jul 2000 00:00:00 | ||||
| Strain | WBStrain00030574 | ||||
| Treatment | Animals were injected with a 1:1 mixture of gfp and aip-1 dsRNAs. Successful RNA interference was determined by the loss of myo-3::gfp expression in muscle tissue of F1 progeny of injected animals. GFP negative animals were raised to the L4 stage and then transferred to plates prepared with 3mM arsenite for survival studies (30 worms/condition). | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F58E10.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000097 | Inferred_automatically | RNAi_primary | ||
| Transcript | F58E10.4.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004641 | ||||
| Phenotype | WBPhenotype:0001379 | Remark | RNAi of aip-1 lowers resistance to toxic effects of arsenite | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
