WormBase Tree Display for RNAi: WBRNAi00001969
expand all nodes | collapse all nodes | view schema
WBRNAi00001969 | History_name | SA:yk363h11 | |||
---|---|---|---|---|---|
Homol | Homol_homol | T08A9:RNAi | |||
Sequence_info | DNA_text | ttttaaaaatcgaaaatttattggtaaaagtttcaaacaagtaaaaatttcaatgatccgtttatgggcattcgttaagcttggtgcacacatcctttggagcggttcctccttccagctcgtgaatgattgggtctaccttgctgttgacgtaatgatcgcattctctggttccgaatgggatggtgtggaaaagcttcttgcattcagcatcgaaatcctagaatattcaagagttgttggtttttttctagcacggatttattaccttcttgatgacattggcatccttatcggcggatccttcgtatttcttgacaaccaactcacacatttgacagctcaatgcgcttctattttctgggatggcaagtcctgaggcaacggcgaccaaaacgg | yk363h11 | ||
Sequence | yk363h11 | ||||
Experiment (2) | |||||
Inhibits | Predicted_gene | T08A9.9 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004990 | Inferred_automatically | RNAi_primary | ||
Transcript | T08A9.9.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0000059 | ||||
Remark | yk363h11 | ||||
L2 arrest | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |