WormBase Tree Display for RNAi: WBRNAi00001715
expand all nodes | collapse all nodes | view schema
WBRNAi00001715 | History_name | SA:yk342d11 | |||
---|---|---|---|---|---|
Homol | Homol_homol | B0252:RNAi | |||
Sequence_info | DNA_text | atagataaaattatgcaaaacatataatgttttttaatcagcagccatcggattcgcgtggatcgtcacattctgtattctgaatattagcaattaatgagagaatttagttttccgtagaaactcacttttgctgaacgagaggtctgtatttattgtcaactttgatcgtttctatttcttctagggtgtcgaatccgtcaatcactctgaaaattatgattgttgcgcaaataatcttaatggtaattccttactttccgaaaagtgtgtacttcatgtcgagatgagcttgcttcgcgtaagtgatgaagaattgcgatcgattggagtcaggtccattgtttgccattgatacgcatcctcgtgagtcatgctaaaaattgaactattttgaaactaagatttaaagtattccgttgtaccttcagagcactaacaaattcgtcttcgaatggtcctccccaaatactttcgccgccttttcccgaatgcgttggatctccagtttgcaccataaaatctttgatgtttctatgaaaaatgcatccattgtagtagtcgctggcacataatgcaagaaaattctgaaataaaatagaatttatattttttagcggttaagaagcataaactgaatttacctcgcaagcttttggcgcatcgtctacataaagctcaattttaatgtctcc | yk342d11 | ||
Sequence | yk342d11 | ||||
Experiment (2) | |||||
Inhibits | Predicted_gene | B0252.4a | Inferred_automatically | RNAi_primary | |
B0252.4b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00000886 | Inferred_automatically | RNAi_primary | ||
Transcript | B0252.4a.1 | Inferred_automatically | RNAi_primary | ||
B0252.4b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed | WBPhenotype:0000050 | ||||
WBPhenotype:0000062 | |||||
WBPhenotype:0000535 | |||||
WBPhenotype:0000689 | |||||
WBPhenotype:0000886 | |||||
Remark | yk342d11 | ||||
cyp-10 | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |