WormBase Tree Display for RNAi: WBRNAi00001503
expand all nodes | collapse all nodes | view schema
WBRNAi00001503 | History_name | SA:yk317c5 | |||
---|---|---|---|---|---|
Homol | Homol_homol | F46B3:RNAi | |||
Sequence_info | DNA_text | cgtgattttgaccgagaacaccaagttccgccaagagaaaataaatcagaccactcggggtttgaaaactggaatctattcaccgctaacgaaaaatggacggatcattgtcaatgacatgttggcctcctgttatagtgaagttcaggcaaacgtacttcagactacatacttttgggttagtggatttgtttaagacttatgaaaacttttaatgctgttttattttcttaaaaaccacattcttttcaggtcttcaaccgtctccgtcaaaaagttctcaacttatttggaattcttcatatgaatgaggtacttaatactgtactacttcctgatagcctacactactttcagattgagcttcccaccggaacagcagtgtacaaagagctcttaagcctagtcatccctatggg | yk317c5 | ||
Sequence | yk317c5 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | F46B3.5 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00001691 | Inferred_automatically | RNAi_primary | ||
Transcript | F46B3.5.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed (5) | |||||
Remark | yk317c5 | ||||
grd-2 | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |