WormBase Tree Display for RNAi: WBRNAi00001292
expand all nodes | collapse all nodes | view schema
WBRNAi00001292 | History_name | SA:yk300d3 | |||
---|---|---|---|---|---|
Homol | Homol_homol | Y39A1A:RNAi | |||
Sequence_info | DNA_text | cgtcaacaaatggcgaatcggtacgtggaaagccgtcggcacacgattcaagtcgatttcctaccgtacctccatgaactcggtgctctaattggttgtaatccagatatgaaggctctttggatgaagaatccattgcttgcttggagagtttattttggtccttgtgttccatatgtgttccgtttaaacggaccaaacacgtggcaaggcgccgaacaggcaatttgggatgttgattatcgatcggagtgtgcgacgaatagtaaagctgtcagaaaggagtaatcgaagaaagaa | yk300d3 | ||
Sequence | yk300d3 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | Y39A1A.19b | Inferred_automatically | RNAi_primary | |
Y39A1A.19a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00001478 | Inferred_automatically | RNAi_primary | ||
Transcript | Y39A1A.19b.2 | Inferred_automatically | RNAi_primary | ||
Y39A1A.19a.1 | Inferred_automatically | RNAi_primary | |||
Y39A1A.19b.1 | Inferred_automatically | RNAi_primary | |||
Y39A1A.19b.3 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0000689 | ||||
WBPhenotype:0001037 | Remark | %penetrance | |||
Penetrance | Range | 6 | |||
Remark | yk300d3 | ||||
F1 sterile (6%),(24hr-) P0 few progeny | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |