WormBase Tree Display for RNAi: WBRNAi00001218
expand all nodes | collapse all nodes | view schema
WBRNAi00001218 | History_name | SA:yk293b6 | |||
---|---|---|---|---|---|
Homol | Homol_homol | R03C1:RNAi | |||
Sequence_info | DNA_text | cccttcaaccgagtgtattattcccccaatttgtttgcaattttttcctgaagccctttaagaaaatccaaaatcatgaccttcttccgtctttacacctgattacctgaataccaacaccccacacagatgccatgatctctcgtcttttctcgtacttttgtataatttttttcttaatttttttgcatgttttcccatagttatagccatttttttttctttttttttccaaatcatcgtca | yk293b6 | ||
Sequence | yk293b6 | ||||
Experiment (2) | |||||
Inhibits | Gene | WBGene00000584 | Inferred_automatically | RNAi_primary | |
Transcript | R03C1.3b.1 | Inferred_automatically | RNAi_primary | ||
R03C1.3a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed | WBPhenotype:0000050 | ||||
WBPhenotype:0000062 | |||||
WBPhenotype:0000535 | |||||
WBPhenotype:0000689 | |||||
WBPhenotype:0000886 | |||||
Remark | yk293b6 | ||||
R03C1,no ORF name is assigned | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |