WormBase Tree Display for RNAi: WBRNAi00000531
expand all nodes | collapse all nodes | view schema
WBRNAi00000531 | History_name | SA:yk209g8 | |||
---|---|---|---|---|---|
Homol | Homol_homol | F59E12:RNAi | |||
Sequence_info | DNA_text | agtttaggaccaaaacgaaaagacaacaacaggagaaagtggtataaataaacggagagatgtttttaattttcaacaagagatataatgttaacaaacgagtgggagttggtgtgaaactaaacgaaattaaccggaaatcaaccagtcatgtttcgtttagctcaaatactttttaaggatcatggtttctggatatcgagtcgtttgagcacatcctgaacctcttgcaacttctgaatatgtcgaatgaaatgttcaccgacgtgacgagcaactttggtatcggcaatattgatcatatcacggtctacgtaaaagtcaatatctgtttgtggctcatcgtcgtctgctgatgatggtccggcttctttgccaagctcattgacgatcatctgaaattcaaaatattacatcaacactcgagatcatcggaaattcttatatataccttgtaagtgagaagctttccaatgaacgaatcatagtgctcatcatcaacatccatgaacgacgcaagcttcttagttggaagtgttgtgtaaagtttcaggtatccacgaagaactggtaacgccatctgtgattcaataccttccaggaaagattgagtttgacgaagaagtggttcttt | yk209g8 | ||
Sequence | yk209g8 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | C17G10.9c | Inferred_automatically | RNAi_primary | |
C17G10.9b | Inferred_automatically | RNAi_primary | |||
C17G10.9e | Inferred_automatically | RNAi_primary | |||
C17G10.9d | Inferred_automatically | RNAi_primary | |||
C17G10.9a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00015920 | Inferred_automatically | RNAi_primary | ||
Transcript | C17G10.9d.1 | Inferred_automatically | RNAi_primary | ||
C17G10.9c.1 | Inferred_automatically | RNAi_primary | |||
C17G10.9b.1 | Inferred_automatically | RNAi_primary | |||
C17G10.9e.1 | Inferred_automatically | RNAi_primary | |||
C17G10.9a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed | WBPhenotype:0000050 | ||||
WBPhenotype:0000062 | |||||
WBPhenotype:0000535 | |||||
WBPhenotype:0000689 | |||||
WBPhenotype:0000886 | |||||
Remark | yk209g8 | ||||
fat-3 | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |