WormBase Tree Display for RNAi: WBRNAi00000182
expand all nodes | collapse all nodes | view schema
WBRNAi00000182 | History_name | KK:F46A9.5 | ||||
---|---|---|---|---|---|---|
Homol | Homol_homol | F30A10:RNAi | ||||
Sequence_info | DNA_text | gcgaagaaggaaccacgctgagccaattccagttcaaaacgtcactgcctcgattctgaagaaggtcattagttggtgcaaccatcatcactccgatcctatctngactgaagattccgataaccgcgagaaaagaactgacgacataggcagctgggacgtcgagtttcttaaggttgaccaaggaacccttttcgagctcatcttggctgccaactatttggacatcaagggacttcttgatgttacctgcaagactgttgctaacatgatcaagggaaaatctccanaanagattcgtcgcactttcaacatcaagaacgacttcaccccggaagaggaanagcaaatccgcaaagagaatgcctggggcgaggattaaattacccttcagtttgcctatttctctattacatttctaaacgacatgtggnttcttccccttcacactttacacattggcctgatatggctct | ||||
Sequence | BE228115 | |||||
Experiment | Laboratory | KK | ||||
Date | 21 Oct 2000 00:00:00 | |||||
Delivered_by | Injection | |||||
Inhibits | Predicted_gene | F46A9.5 | Inferred_automatically | RNAi_primary | ||
Gene | WBGene00004807 | Inferred_automatically | RNAi_primary | |||
Transcript | F46A9.5.1 | Inferred_automatically | RNAi_primary | |||
Supporting_data | Movie | WBMovie0000000910 | ||||
WBMovie0000000911 | ||||||
WBMovie0000000912 | ||||||
WBMovie0000000913 | ||||||
WBMovie0000000914 | ||||||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00004540 | |||||
Phenotype | WBPhenotype:0000050 | Remark | % penetrance range | |||
Penetrance | Range | 80 | 100 | |||
WBPhenotype:0000689 | ||||||
Remark | Embryonic lethal; P0 spindle positioning problems; polar bodies abnormal; multiple nuclei; abnormal blebbing; ectopic furrows | |||||
Mapping of BE228115 to SUPERLINK_CB_I does not represent the best hit. It was carried out using BLAT_EST_OTHER method | ||||||
Method | RNAi |