WormBase Tree Display for RNAi: WBRNAi00000182
expand all nodes | collapse all nodes | view schema
| WBRNAi00000182 | History_name | KK:F46A9.5 | ||||
|---|---|---|---|---|---|---|
| Homol | Homol_homol | F30A10:RNAi | ||||
| Sequence_info | DNA_text | gcgaagaaggaaccacgctgagccaattccagttcaaaacgtcactgcctcgattctgaagaaggtcattagttggtgcaaccatcatcactccgatcctatctngactgaagattccgataaccgcgagaaaagaactgacgacataggcagctgggacgtcgagtttcttaaggttgaccaaggaacccttttcgagctcatcttggctgccaactatttggacatcaagggacttcttgatgttacctgcaagactgttgctaacatgatcaagggaaaatctccanaanagattcgtcgcactttcaacatcaagaacgacttcaccccggaagaggaanagcaaatccgcaaagagaatgcctggggcgaggattaaattacccttcagtttgcctatttctctattacatttctaaacgacatgtggnttcttccccttcacactttacacattggcctgatatggctct | ||||
| Sequence | BE228115 | |||||
| Experiment | Laboratory | KK | ||||
| Date | 21 Oct 2000 00:00:00 | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | F46A9.5 | Inferred_automatically | RNAi_primary | ||
| Gene | WBGene00004807 | Inferred_automatically | RNAi_primary | |||
| Transcript | F46A9.5.1 | Inferred_automatically | RNAi_primary | |||
| Supporting_data | Movie | WBMovie0000000910 | ||||
| WBMovie0000000911 | ||||||
| WBMovie0000000912 | ||||||
| WBMovie0000000913 | ||||||
| WBMovie0000000914 | ||||||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00004540 | |||||
| Phenotype | WBPhenotype:0000050 | Remark | % penetrance range | |||
| Penetrance | Range | 80 | 100 | |||
| WBPhenotype:0000689 | ||||||
| Remark | Embryonic lethal; P0 spindle positioning problems; polar bodies abnormal; multiple nuclei; abnormal blebbing; ectopic furrows | |||||
| Mapping of BE228115 to SUPERLINK_CB_I does not represent the best hit. It was carried out using BLAT_EST_OTHER method | ||||||
| Method | RNAi |
